Incidental Mutation 'R7651:Tacc2'
ID590837
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7651 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130623154 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 523 (H523L)
Ref Sequence ENSEMBL: ENSMUSP00000081561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]
Predicted Effect probably benign
Transcript: ENSMUST00000059145
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084513
AA Change: H523L

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: H523L

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect probably benign
Transcript: ENSMUST00000207918
AA Change: H523L

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000208722
Predicted Effect probably benign
Transcript: ENSMUST00000215492
AA Change: H542L

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,293,362 V302G Het
A230072I06Rik T C 8: 12,279,689 I48T unknown Het
A430089I19Rik T C 5: 94,303,377 T297A probably benign Het
Ada T A 2: 163,732,355 D127V probably damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd34c T C 9: 89,729,410 R293G possibly damaging Het
Ap2b1 T C 11: 83,339,430 probably null Het
Arhgef16 A G 4: 154,291,067 S157P probably damaging Het
Atp2b1 C T 10: 99,016,968 L1036F probably damaging Het
Ccdc27 A T 4: 154,028,099 I573N probably damaging Het
Cep164 T C 9: 45,773,852 E869G probably benign Het
Colq A T 14: 31,528,335 V381D possibly damaging Het
Drc1 A G 5: 30,359,614 E519G probably benign Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Epg5 C T 18: 77,981,400 Q1157* probably null Het
Eqtn T C 4: 94,923,707 S150G possibly damaging Het
Fam216a G A 5: 122,367,382 H172Y probably damaging Het
Fbxw19 T A 9: 109,494,646 D87V probably damaging Het
Fgr A T 4: 132,995,013 I198F probably damaging Het
Flnc A G 6: 29,444,050 D621G probably benign Het
Flt3 A C 5: 147,354,922 Y573D probably damaging Het
Git2 A T 5: 114,733,235 I603N probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gnb5 T C 9: 75,343,571 F326L probably damaging Het
Grm8 A T 6: 27,760,258 W358R possibly damaging Het
Grrp1 C T 4: 134,251,648 R173H probably damaging Het
Hoxa3 A G 6: 52,172,273 V126A unknown Het
Hras T C 7: 141,192,151 T144A possibly damaging Het
Hyal1 G A 9: 107,578,370 R293H probably damaging Het
Ifnlr1 A G 4: 135,690,608 S49G possibly damaging Het
Ighv8-11 C A 12: 115,567,385 C41F probably benign Het
Jakmip1 A G 5: 37,134,273 T689A probably damaging Het
Kcnb1 T C 2: 167,188,361 H88R probably damaging Het
Kcnt2 T A 1: 140,570,461 M892K probably benign Het
Lrba C A 3: 86,741,466 S2507* probably null Het
Mbp C T 18: 82,554,374 T65I probably damaging Het
Muc2 A T 7: 141,704,201 Y12F Het
Muc4 T A 16: 32,756,575 S80T Het
Muc5ac A G 7: 141,796,254 D579G possibly damaging Het
Muc5b A G 7: 141,864,023 T3569A possibly damaging Het
Myb C T 10: 21,156,374 R36H probably damaging Het
Myo6 T C 9: 80,264,266 probably null Het
Ogfod1 T C 8: 94,037,353 V22A probably benign Het
Orai3 A G 7: 127,774,064 I246V probably damaging Het
Otog A G 7: 46,241,761 M68V probably benign Het
Pcdh20 T A 14: 88,469,153 D237V probably damaging Het
Pcdhb18 T C 18: 37,490,993 F459L probably benign Het
Pik3c2g C T 6: 139,622,072 T62M possibly damaging Het
Plaa T C 4: 94,582,639 Y420C probably damaging Het
Ppp1r9b C T 11: 95,001,942 A656V probably benign Het
Prg4 T A 1: 150,454,945 E659V unknown Het
Prlhr C A 19: 60,467,145 A328S probably benign Het
Prlr A T 15: 10,328,378 D313V probably benign Het
Prune2 C T 19: 17,120,408 T1092I probably damaging Het
Psme4 T A 11: 30,837,334 L1043H probably damaging Het
Ptprr T C 10: 116,251,179 V521A probably benign Het
Rab44 A T 17: 29,148,205 D703V unknown Het
Rpl9-ps1 A T 11: 83,645,085 Y179* probably null Het
Scg3 T A 9: 75,682,050 N107I probably benign Het
Sh3bgrl2 T C 9: 83,548,472 V5A possibly damaging Het
Slc7a12 T C 3: 14,481,449 V218A probably benign Het
Sorcs2 A G 5: 36,027,978 L918P probably damaging Het
Sox1 C A 8: 12,396,686 A109E probably damaging Het
Syne1 T A 10: 5,205,074 M5622L probably benign Het
Syne1 A T 10: 5,343,416 L1305Q probably damaging Het
Tas1r2 A T 4: 139,669,627 D788V probably benign Het
Tcl1b5 T A 12: 105,176,435 D7E possibly damaging Het
Tesc A G 5: 118,056,601 D159G possibly damaging Het
Tm2d2 G T 8: 25,017,300 probably benign Het
Tnfrsf11a T A 1: 105,809,446 C93S probably damaging Het
Tnfsf4 T C 1: 161,417,022 V94A probably benign Het
Trav13n-3 T A 14: 53,337,507 Y69N probably benign Het
Utp20 T C 10: 88,754,595 D2339G probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r114 G T 17: 23,291,012 Y831* probably null Het
Vmn2r72 T A 7: 85,751,938 N91I probably damaging Het
Zfp846 T C 9: 20,588,512 S13P possibly damaging Het
Zfp934 G T 13: 62,518,513 N116K probably benign Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
aces UTSW 7 130733528 missense probably damaging 1.00
Jacks UTSW 7 130625764 missense probably damaging 0.98
kings UTSW 7 130623483 missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
R7111:Tacc2 UTSW 7 130728888 missense probably benign 0.16
R7150:Tacc2 UTSW 7 130729077 missense probably benign
R7290:Tacc2 UTSW 7 130729373 missense probably benign 0.07
R7404:Tacc2 UTSW 7 130623336 missense probably benign 0.22
R7460:Tacc2 UTSW 7 130624633 missense probably benign 0.39
R7666:Tacc2 UTSW 7 130716814 start gained probably benign
R7695:Tacc2 UTSW 7 130728903 missense probably benign 0.08
R7766:Tacc2 UTSW 7 130743598 missense probably damaging 1.00
R7793:Tacc2 UTSW 7 130623113 missense probably benign 0.34
R7861:Tacc2 UTSW 7 130625431 missense probably benign 0.00
R7944:Tacc2 UTSW 7 130625431 missense probably benign 0.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Z1176:Tacc2 UTSW 7 130623370 missense probably benign 0.01
Z1176:Tacc2 UTSW 7 130624270 missense possibly damaging 0.59
Z1176:Tacc2 UTSW 7 130744597 missense probably damaging 1.00
Z1177:Tacc2 UTSW 7 130624980 missense probably damaging 1.00
Z1177:Tacc2 UTSW 7 130625774 missense probably damaging 0.99
Z1177:Tacc2 UTSW 7 130734949 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGCTGCCACAGAACAGATG -3'
(R):5'- CTGAGCTGGGAACGATTTTG -3'

Sequencing Primer
(F):5'- AAGGTAGCCTCCAGCAGGTTC -3'
(R):5'- ACGATTTTGTTCTCTGTATTACTGTG -3'
Posted On2019-10-24