Incidental Mutation 'R7651:Muc2'
ID 590839
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 045728-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7651 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141290750 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 12 (Y12F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000185823]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000167366
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185823
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187789
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,184,188 (GRCm39) V302G Het
A230072I06Rik T C 8: 12,329,689 (GRCm39) I48T unknown Het
Ada T A 2: 163,574,275 (GRCm39) D127V probably damaging Het
Alb G C 5: 90,615,214 (GRCm39) R242P probably damaging Het
Ankrd34c T C 9: 89,611,463 (GRCm39) R293G possibly damaging Het
Ap2b1 T C 11: 83,230,256 (GRCm39) probably null Het
Arhgef16 A G 4: 154,375,524 (GRCm39) S157P probably damaging Het
Atp2b1 C T 10: 98,852,830 (GRCm39) L1036F probably damaging Het
Ccdc27 A T 4: 154,112,556 (GRCm39) I573N probably damaging Het
Cep164 T C 9: 45,685,150 (GRCm39) E869G probably benign Het
Colq A T 14: 31,250,292 (GRCm39) V381D possibly damaging Het
Drc1 A G 5: 30,516,958 (GRCm39) E519G probably benign Het
Drosha G A 15: 12,859,522 (GRCm39) V577I probably benign Het
Epg5 C T 18: 78,024,615 (GRCm39) Q1157* probably null Het
Eqtn T C 4: 94,811,944 (GRCm39) S150G possibly damaging Het
Fam110d C T 4: 133,978,959 (GRCm39) R173H probably damaging Het
Fam216a G A 5: 122,505,445 (GRCm39) H172Y probably damaging Het
Fbxw19 T A 9: 109,323,714 (GRCm39) D87V probably damaging Het
Fgr A T 4: 132,722,324 (GRCm39) I198F probably damaging Het
Flnc A G 6: 29,444,049 (GRCm39) D621G probably benign Het
Flt3 A C 5: 147,291,732 (GRCm39) Y573D probably damaging Het
Git2 A T 5: 114,871,296 (GRCm39) I603N probably damaging Het
Gm4559 C T 7: 141,827,553 (GRCm39) R183K unknown Het
Gnb5 T C 9: 75,250,853 (GRCm39) F326L probably damaging Het
Grm8 A T 6: 27,760,257 (GRCm39) W358R possibly damaging Het
Hoxa3 A G 6: 52,149,253 (GRCm39) V126A unknown Het
Hras T C 7: 140,772,064 (GRCm39) T144A possibly damaging Het
Hyal1 G A 9: 107,455,569 (GRCm39) R293H probably damaging Het
Ifnlr1 A G 4: 135,417,919 (GRCm39) S49G possibly damaging Het
Ighv8-11 C A 12: 115,531,005 (GRCm39) C41F probably benign Het
Jakmip1 A G 5: 37,291,617 (GRCm39) T689A probably damaging Het
Kcnb1 T C 2: 167,030,281 (GRCm39) H88R probably damaging Het
Kcnt2 T A 1: 140,498,199 (GRCm39) M892K probably benign Het
Lrba C A 3: 86,648,773 (GRCm39) S2507* probably null Het
Mbp C T 18: 82,572,499 (GRCm39) T65I probably damaging Het
Muc4 T A 16: 32,576,949 (GRCm39) S80T Het
Muc5ac A G 7: 141,349,991 (GRCm39) D579G possibly damaging Het
Muc5b A G 7: 141,417,760 (GRCm39) T3569A possibly damaging Het
Myb C T 10: 21,032,273 (GRCm39) R36H probably damaging Het
Myo6 T C 9: 80,171,548 (GRCm39) probably null Het
Ogfod1 T C 8: 94,763,981 (GRCm39) V22A probably benign Het
Orai3 A G 7: 127,373,236 (GRCm39) I246V probably damaging Het
Otog A G 7: 45,891,185 (GRCm39) M68V probably benign Het
Pcdh20 T A 14: 88,706,589 (GRCm39) D237V probably damaging Het
Pcdhb18 T C 18: 37,624,046 (GRCm39) F459L probably benign Het
Pik3c2g C T 6: 139,599,070 (GRCm39) T62M possibly damaging Het
Plaa T C 4: 94,470,876 (GRCm39) Y420C probably damaging Het
Ppp1r9b C T 11: 94,892,768 (GRCm39) A656V probably benign Het
Pramel39-ps T C 5: 94,451,236 (GRCm39) T297A probably benign Het
Prg4 T A 1: 150,330,696 (GRCm39) E659V unknown Het
Prlhr C A 19: 60,455,583 (GRCm39) A328S probably benign Het
Prlr A T 15: 10,328,464 (GRCm39) D313V probably benign Het
Prune2 C T 19: 17,097,772 (GRCm39) T1092I probably damaging Het
Psme4 T A 11: 30,787,334 (GRCm39) L1043H probably damaging Het
Ptprr T C 10: 116,087,084 (GRCm39) V521A probably benign Het
Rab44 A T 17: 29,367,179 (GRCm39) D703V unknown Het
Rpl9-ps1 A T 11: 83,535,911 (GRCm39) Y179* probably null Het
Scg3 T A 9: 75,589,332 (GRCm39) N107I probably benign Het
Sh3bgrl2 T C 9: 83,430,525 (GRCm39) V5A possibly damaging Het
Slc7a12 T C 3: 14,546,509 (GRCm39) V218A probably benign Het
Sorcs2 A G 5: 36,185,322 (GRCm39) L918P probably damaging Het
Sox1 C A 8: 12,446,686 (GRCm39) A109E probably damaging Het
Syne1 T A 10: 5,155,074 (GRCm39) M5622L probably benign Het
Syne1 A T 10: 5,293,416 (GRCm39) L1305Q probably damaging Het
Tacc2 A T 7: 130,224,884 (GRCm39) H523L probably benign Het
Tas1r2 A T 4: 139,396,938 (GRCm39) D788V probably benign Het
Tcl1b5 T A 12: 105,142,694 (GRCm39) D7E possibly damaging Het
Tesc A G 5: 118,194,666 (GRCm39) D159G possibly damaging Het
Tm2d2 G T 8: 25,507,316 (GRCm39) probably benign Het
Tnfrsf11a T A 1: 105,737,171 (GRCm39) C93S probably damaging Het
Tnfsf4 T C 1: 161,244,593 (GRCm39) V94A probably benign Het
Trav13n-3 T A 14: 53,574,964 (GRCm39) Y69N probably benign Het
Utp20 T C 10: 88,590,457 (GRCm39) D2339G probably benign Het
Vmn1r225 A G 17: 20,722,611 (GRCm39) I17M possibly damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r114 G T 17: 23,509,986 (GRCm39) Y831* probably null Het
Vmn2r72 T A 7: 85,401,146 (GRCm39) N91I probably damaging Het
Zfp846 T C 9: 20,499,808 (GRCm39) S13P possibly damaging Het
Zfp934 G T 13: 62,666,327 (GRCm39) N116K probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CTCTGACTGGGTTAATACAACTTGG -3'
(R):5'- TGGATAGCAACAGTTGACTCG -3'

Sequencing Primer
(F):5'- CTGGGTTAATACAACTTGGTCATTG -3'
(R):5'- GGATAGCAACAGTTGACTCGTATCTC -3'
Posted On 2019-10-24