Mutagenetix > Incidental Mutation

Incidental Mutation 'R7651:Muc2'

590839

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R7651 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 141704201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 12 (Y12F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	T	G	11: 58,293,362	V302G		Het
A230072I06Rik	T	C	8: 12,279,689	I48T	unknown	Het
A430089I19Rik	T	C	5: 94,303,377	T297A	probably benign	Het
Ada	T	A	2: 163,732,355	D127V	probably damaging	Het
Alb	G	C	5: 90,467,355	R242P	probably damaging	Het
Ankrd34c	T	C	9: 89,729,410	R293G	possibly damaging	Het
Ap2b1	T	C	11: 83,339,430		probably null	Het
Arhgef16	A	G	4: 154,291,067	S157P	probably damaging	Het
Atp2b1	C	T	10: 99,016,968	L1036F	probably damaging	Het
Ccdc27	A	T	4: 154,028,099	I573N	probably damaging	Het
Cep164	T	C	9: 45,773,852	E869G	probably benign	Het
Colq	A	T	14: 31,528,335	V381D	possibly damaging	Het
Drc1	A	G	5: 30,359,614	E519G	probably benign	Het
Drosha	G	A	15: 12,859,436	V577I	probably benign	Het
Epg5	C	T	18: 77,981,400	Q1157*	probably null	Het
Eqtn	T	C	4: 94,923,707	S150G	possibly damaging	Het
Fam216a	G	A	5: 122,367,382	H172Y	probably damaging	Het
Fbxw19	T	A	9: 109,494,646	D87V	probably damaging	Het
Fgr	A	T	4: 132,995,013	I198F	probably damaging	Het
Flnc	A	G	6: 29,444,050	D621G	probably benign	Het
Flt3	A	C	5: 147,354,922	Y573D	probably damaging	Het
Git2	A	T	5: 114,733,235	I603N	probably damaging	Het
Gm4559	C	T	7: 142,273,816	R183K	unknown	Het
Gnb5	T	C	9: 75,343,571	F326L	probably damaging	Het
Grm8	A	T	6: 27,760,258	W358R	possibly damaging	Het
Grrp1	C	T	4: 134,251,648	R173H	probably damaging	Het
Hoxa3	A	G	6: 52,172,273	V126A	unknown	Het
Hras	T	C	7: 141,192,151	T144A	possibly damaging	Het
Hyal1	G	A	9: 107,578,370	R293H	probably damaging	Het
Ifnlr1	A	G	4: 135,690,608	S49G	possibly damaging	Het
Ighv8-11	C	A	12: 115,567,385	C41F	probably benign	Het
Jakmip1	A	G	5: 37,134,273	T689A	probably damaging	Het
Kcnb1	T	C	2: 167,188,361	H88R	probably damaging	Het
Kcnt2	T	A	1: 140,570,461	M892K	probably benign	Het
Lrba	C	A	3: 86,741,466	S2507*	probably null	Het
Mbp	C	T	18: 82,554,374	T65I	probably damaging	Het
Muc4	T	A	16: 32,756,575	S80T		Het
Muc5ac	A	G	7: 141,796,254	D579G	possibly damaging	Het
Muc5b	A	G	7: 141,864,023	T3569A	possibly damaging	Het
Myb	C	T	10: 21,156,374	R36H	probably damaging	Het
Myo6	T	C	9: 80,264,266		probably null	Het
Ogfod1	T	C	8: 94,037,353	V22A	probably benign	Het
Orai3	A	G	7: 127,774,064	I246V	probably damaging	Het
Otog	A	G	7: 46,241,761	M68V	probably benign	Het
Pcdh20	T	A	14: 88,469,153	D237V	probably damaging	Het
Pcdhb18	T	C	18: 37,490,993	F459L	probably benign	Het
Pik3c2g	C	T	6: 139,622,072	T62M	possibly damaging	Het
Plaa	T	C	4: 94,582,639	Y420C	probably damaging	Het
Ppp1r9b	C	T	11: 95,001,942	A656V	probably benign	Het
Prg4	T	A	1: 150,454,945	E659V	unknown	Het
Prlhr	C	A	19: 60,467,145	A328S	probably benign	Het
Prlr	A	T	15: 10,328,378	D313V	probably benign	Het
Prune2	C	T	19: 17,120,408	T1092I	probably damaging	Het
Psme4	T	A	11: 30,837,334	L1043H	probably damaging	Het
Ptprr	T	C	10: 116,251,179	V521A	probably benign	Het
Rab44	A	T	17: 29,148,205	D703V	unknown	Het
Rpl9-ps1	A	T	11: 83,645,085	Y179*	probably null	Het
Scg3	T	A	9: 75,682,050	N107I	probably benign	Het
Sh3bgrl2	T	C	9: 83,548,472	V5A	possibly damaging	Het
Slc7a12	T	C	3: 14,481,449	V218A	probably benign	Het
Sorcs2	A	G	5: 36,027,978	L918P	probably damaging	Het
Sox1	C	A	8: 12,396,686	A109E	probably damaging	Het
Syne1	T	A	10: 5,205,074	M5622L	probably benign	Het
Syne1	A	T	10: 5,343,416	L1305Q	probably damaging	Het
Tacc2	A	T	7: 130,623,154	H523L	probably benign	Het
Tas1r2	A	T	4: 139,669,627	D788V	probably benign	Het
Tcl1b5	T	A	12: 105,176,435	D7E	possibly damaging	Het
Tesc	A	G	5: 118,056,601	D159G	possibly damaging	Het
Tm2d2	G	T	8: 25,017,300		probably benign	Het
Tnfrsf11a	T	A	1: 105,809,446	C93S	probably damaging	Het
Tnfsf4	T	C	1: 161,417,022	V94A	probably benign	Het
Trav13n-3	T	A	14: 53,337,507	Y69N	probably benign	Het
Utp20	T	C	10: 88,754,595	D2339G	probably benign	Het
Vmn1r225	A	G	17: 20,502,349	I17M	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r114	G	T	17: 23,291,012	Y831*	probably null	Het
Vmn2r72	T	A	7: 85,751,938	N91I	probably damaging	Het
Zfp846	T	C	9: 20,588,512	S13P	possibly damaging	Het
Zfp934	G	T	13: 62,518,513	N116K	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- CTCTGACTGGGTTAATACAACTTGG -3'
(R):5'- TGGATAGCAACAGTTGACTCG -3'

Sequencing Primer
(F):5'- CTGGGTTAATACAACTTGGTCATTG -3'
(R):5'- GGATAGCAACAGTTGACTCGTATCTC -3'

Posted On

2019-10-24