Incidental Mutation 'R7651:Psme4'
ID 590862
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 045728-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7651 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30787334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 1043 (L1043H)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: L1043H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: L1043H

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,184,188 (GRCm39) V302G Het
A230072I06Rik T C 8: 12,329,689 (GRCm39) I48T unknown Het
Ada T A 2: 163,574,275 (GRCm39) D127V probably damaging Het
Alb G C 5: 90,615,214 (GRCm39) R242P probably damaging Het
Ankrd34c T C 9: 89,611,463 (GRCm39) R293G possibly damaging Het
Ap2b1 T C 11: 83,230,256 (GRCm39) probably null Het
Arhgef16 A G 4: 154,375,524 (GRCm39) S157P probably damaging Het
Atp2b1 C T 10: 98,852,830 (GRCm39) L1036F probably damaging Het
Ccdc27 A T 4: 154,112,556 (GRCm39) I573N probably damaging Het
Cep164 T C 9: 45,685,150 (GRCm39) E869G probably benign Het
Colq A T 14: 31,250,292 (GRCm39) V381D possibly damaging Het
Drc1 A G 5: 30,516,958 (GRCm39) E519G probably benign Het
Drosha G A 15: 12,859,522 (GRCm39) V577I probably benign Het
Epg5 C T 18: 78,024,615 (GRCm39) Q1157* probably null Het
Eqtn T C 4: 94,811,944 (GRCm39) S150G possibly damaging Het
Fam110d C T 4: 133,978,959 (GRCm39) R173H probably damaging Het
Fam216a G A 5: 122,505,445 (GRCm39) H172Y probably damaging Het
Fbxw19 T A 9: 109,323,714 (GRCm39) D87V probably damaging Het
Fgr A T 4: 132,722,324 (GRCm39) I198F probably damaging Het
Flnc A G 6: 29,444,049 (GRCm39) D621G probably benign Het
Flt3 A C 5: 147,291,732 (GRCm39) Y573D probably damaging Het
Git2 A T 5: 114,871,296 (GRCm39) I603N probably damaging Het
Gm4559 C T 7: 141,827,553 (GRCm39) R183K unknown Het
Gnb5 T C 9: 75,250,853 (GRCm39) F326L probably damaging Het
Grm8 A T 6: 27,760,257 (GRCm39) W358R possibly damaging Het
Hoxa3 A G 6: 52,149,253 (GRCm39) V126A unknown Het
Hras T C 7: 140,772,064 (GRCm39) T144A possibly damaging Het
Hyal1 G A 9: 107,455,569 (GRCm39) R293H probably damaging Het
Ifnlr1 A G 4: 135,417,919 (GRCm39) S49G possibly damaging Het
Ighv8-11 C A 12: 115,531,005 (GRCm39) C41F probably benign Het
Jakmip1 A G 5: 37,291,617 (GRCm39) T689A probably damaging Het
Kcnb1 T C 2: 167,030,281 (GRCm39) H88R probably damaging Het
Kcnt2 T A 1: 140,498,199 (GRCm39) M892K probably benign Het
Lrba C A 3: 86,648,773 (GRCm39) S2507* probably null Het
Mbp C T 18: 82,572,499 (GRCm39) T65I probably damaging Het
Muc2 A T 7: 141,290,750 (GRCm39) Y12F Het
Muc4 T A 16: 32,576,949 (GRCm39) S80T Het
Muc5ac A G 7: 141,349,991 (GRCm39) D579G possibly damaging Het
Muc5b A G 7: 141,417,760 (GRCm39) T3569A possibly damaging Het
Myb C T 10: 21,032,273 (GRCm39) R36H probably damaging Het
Myo6 T C 9: 80,171,548 (GRCm39) probably null Het
Ogfod1 T C 8: 94,763,981 (GRCm39) V22A probably benign Het
Orai3 A G 7: 127,373,236 (GRCm39) I246V probably damaging Het
Otog A G 7: 45,891,185 (GRCm39) M68V probably benign Het
Pcdh20 T A 14: 88,706,589 (GRCm39) D237V probably damaging Het
Pcdhb18 T C 18: 37,624,046 (GRCm39) F459L probably benign Het
Pik3c2g C T 6: 139,599,070 (GRCm39) T62M possibly damaging Het
Plaa T C 4: 94,470,876 (GRCm39) Y420C probably damaging Het
Ppp1r9b C T 11: 94,892,768 (GRCm39) A656V probably benign Het
Pramel39-ps T C 5: 94,451,236 (GRCm39) T297A probably benign Het
Prg4 T A 1: 150,330,696 (GRCm39) E659V unknown Het
Prlhr C A 19: 60,455,583 (GRCm39) A328S probably benign Het
Prlr A T 15: 10,328,464 (GRCm39) D313V probably benign Het
Prune2 C T 19: 17,097,772 (GRCm39) T1092I probably damaging Het
Ptprr T C 10: 116,087,084 (GRCm39) V521A probably benign Het
Rab44 A T 17: 29,367,179 (GRCm39) D703V unknown Het
Rpl9-ps1 A T 11: 83,535,911 (GRCm39) Y179* probably null Het
Scg3 T A 9: 75,589,332 (GRCm39) N107I probably benign Het
Sh3bgrl2 T C 9: 83,430,525 (GRCm39) V5A possibly damaging Het
Slc7a12 T C 3: 14,546,509 (GRCm39) V218A probably benign Het
Sorcs2 A G 5: 36,185,322 (GRCm39) L918P probably damaging Het
Sox1 C A 8: 12,446,686 (GRCm39) A109E probably damaging Het
Syne1 T A 10: 5,155,074 (GRCm39) M5622L probably benign Het
Syne1 A T 10: 5,293,416 (GRCm39) L1305Q probably damaging Het
Tacc2 A T 7: 130,224,884 (GRCm39) H523L probably benign Het
Tas1r2 A T 4: 139,396,938 (GRCm39) D788V probably benign Het
Tcl1b5 T A 12: 105,142,694 (GRCm39) D7E possibly damaging Het
Tesc A G 5: 118,194,666 (GRCm39) D159G possibly damaging Het
Tm2d2 G T 8: 25,507,316 (GRCm39) probably benign Het
Tnfrsf11a T A 1: 105,737,171 (GRCm39) C93S probably damaging Het
Tnfsf4 T C 1: 161,244,593 (GRCm39) V94A probably benign Het
Trav13n-3 T A 14: 53,574,964 (GRCm39) Y69N probably benign Het
Utp20 T C 10: 88,590,457 (GRCm39) D2339G probably benign Het
Vmn1r225 A G 17: 20,722,611 (GRCm39) I17M possibly damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r114 G T 17: 23,509,986 (GRCm39) Y831* probably null Het
Vmn2r72 T A 7: 85,401,146 (GRCm39) N91I probably damaging Het
Zfp846 T C 9: 20,499,808 (GRCm39) S13P possibly damaging Het
Zfp934 G T 13: 62,666,327 (GRCm39) N116K probably benign Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R3876:Psme4 UTSW 11 30,806,068 (GRCm39) missense probably damaging 0.99
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCACTTGCTTATACCTCAAG -3'
(R):5'- ATGACCTGACTCATCCCCAG -3'

Sequencing Primer
(F):5'- TGCTTATACCTCAAGTTCCTGG -3'
(R):5'- TGACTCATCCCCAGACACATTC -3'
Posted On 2019-10-24