Incidental Mutation 'R7651:Psme4'
ID 590862
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7651 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 30771726-30880361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30837334 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 1043 (L1043H)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: L1043H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: L1043H

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,293,362 V302G Het
A230072I06Rik T C 8: 12,279,689 I48T unknown Het
A430089I19Rik T C 5: 94,303,377 T297A probably benign Het
Ada T A 2: 163,732,355 D127V probably damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd34c T C 9: 89,729,410 R293G possibly damaging Het
Ap2b1 T C 11: 83,339,430 probably null Het
Arhgef16 A G 4: 154,291,067 S157P probably damaging Het
Atp2b1 C T 10: 99,016,968 L1036F probably damaging Het
Ccdc27 A T 4: 154,028,099 I573N probably damaging Het
Cep164 T C 9: 45,773,852 E869G probably benign Het
Colq A T 14: 31,528,335 V381D possibly damaging Het
Drc1 A G 5: 30,359,614 E519G probably benign Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Epg5 C T 18: 77,981,400 Q1157* probably null Het
Eqtn T C 4: 94,923,707 S150G possibly damaging Het
Fam216a G A 5: 122,367,382 H172Y probably damaging Het
Fbxw19 T A 9: 109,494,646 D87V probably damaging Het
Fgr A T 4: 132,995,013 I198F probably damaging Het
Flnc A G 6: 29,444,050 D621G probably benign Het
Flt3 A C 5: 147,354,922 Y573D probably damaging Het
Git2 A T 5: 114,733,235 I603N probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gnb5 T C 9: 75,343,571 F326L probably damaging Het
Grm8 A T 6: 27,760,258 W358R possibly damaging Het
Grrp1 C T 4: 134,251,648 R173H probably damaging Het
Hoxa3 A G 6: 52,172,273 V126A unknown Het
Hras T C 7: 141,192,151 T144A possibly damaging Het
Hyal1 G A 9: 107,578,370 R293H probably damaging Het
Ifnlr1 A G 4: 135,690,608 S49G possibly damaging Het
Ighv8-11 C A 12: 115,567,385 C41F probably benign Het
Jakmip1 A G 5: 37,134,273 T689A probably damaging Het
Kcnb1 T C 2: 167,188,361 H88R probably damaging Het
Kcnt2 T A 1: 140,570,461 M892K probably benign Het
Lrba C A 3: 86,741,466 S2507* probably null Het
Mbp C T 18: 82,554,374 T65I probably damaging Het
Muc2 A T 7: 141,704,201 Y12F Het
Muc4 T A 16: 32,756,575 S80T Het
Muc5ac A G 7: 141,796,254 D579G possibly damaging Het
Muc5b A G 7: 141,864,023 T3569A possibly damaging Het
Myb C T 10: 21,156,374 R36H probably damaging Het
Myo6 T C 9: 80,264,266 probably null Het
Ogfod1 T C 8: 94,037,353 V22A probably benign Het
Orai3 A G 7: 127,774,064 I246V probably damaging Het
Otog A G 7: 46,241,761 M68V probably benign Het
Pcdh20 T A 14: 88,469,153 D237V probably damaging Het
Pcdhb18 T C 18: 37,490,993 F459L probably benign Het
Pik3c2g C T 6: 139,622,072 T62M possibly damaging Het
Plaa T C 4: 94,582,639 Y420C probably damaging Het
Ppp1r9b C T 11: 95,001,942 A656V probably benign Het
Prg4 T A 1: 150,454,945 E659V unknown Het
Prlhr C A 19: 60,467,145 A328S probably benign Het
Prlr A T 15: 10,328,378 D313V probably benign Het
Prune2 C T 19: 17,120,408 T1092I probably damaging Het
Ptprr T C 10: 116,251,179 V521A probably benign Het
Rab44 A T 17: 29,148,205 D703V unknown Het
Rpl9-ps1 A T 11: 83,645,085 Y179* probably null Het
Scg3 T A 9: 75,682,050 N107I probably benign Het
Sh3bgrl2 T C 9: 83,548,472 V5A possibly damaging Het
Slc7a12 T C 3: 14,481,449 V218A probably benign Het
Sorcs2 A G 5: 36,027,978 L918P probably damaging Het
Sox1 C A 8: 12,396,686 A109E probably damaging Het
Syne1 T A 10: 5,205,074 M5622L probably benign Het
Syne1 A T 10: 5,343,416 L1305Q probably damaging Het
Tacc2 A T 7: 130,623,154 H523L probably benign Het
Tas1r2 A T 4: 139,669,627 D788V probably benign Het
Tcl1b5 T A 12: 105,176,435 D7E possibly damaging Het
Tesc A G 5: 118,056,601 D159G possibly damaging Het
Tm2d2 G T 8: 25,017,300 probably benign Het
Tnfrsf11a T A 1: 105,809,446 C93S probably damaging Het
Tnfsf4 T C 1: 161,417,022 V94A probably benign Het
Trav13n-3 T A 14: 53,337,507 Y69N probably benign Het
Utp20 T C 10: 88,754,595 D2339G probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r114 G T 17: 23,291,012 Y831* probably null Het
Vmn2r72 T A 7: 85,751,938 N91I probably damaging Het
Zfp846 T C 9: 20,588,512 S13P possibly damaging Het
Zfp934 G T 13: 62,518,513 N116K probably benign Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
R8998:Psme4 UTSW 11 30838957 missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30865576 missense probably damaging 1.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCACTTGCTTATACCTCAAG -3'
(R):5'- ATGACCTGACTCATCCCCAG -3'

Sequencing Primer
(F):5'- TGCTTATACCTCAAGTTCCTGG -3'
(R):5'- TGACTCATCCCCAGACACATTC -3'
Posted On 2019-10-24