Incidental Mutation 'R7651:Zfp934'
ID590869
Institutional Source Beutler Lab
Gene Symbol Zfp934
Ensembl Gene ENSMUSG00000074865
Gene Namezinc finger protein 934
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R7651 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location62479827-62571199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62518513 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 116 (N116K)
Ref Sequence ENSEMBL: ENSMUSP00000152804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076195] [ENSMUST00000082203] [ENSMUST00000101547] [ENSMUST00000220648] [ENSMUST00000221250] [ENSMUST00000222429] [ENSMUST00000222746] [ENSMUST00000222852]
Predicted Effect probably benign
Transcript: ENSMUST00000076195
SMART Domains Protein: ENSMUSP00000075552
Gene: ENSMUSG00000055228

DomainStartEndE-ValueType
KRAB 4 66 8.26e-16 SMART
ZnF_C2H2 133 155 2.09e-3 SMART
ZnF_C2H2 161 183 1.4e-4 SMART
ZnF_C2H2 189 211 2.57e-3 SMART
ZnF_C2H2 217 239 5.5e-3 SMART
ZnF_C2H2 245 267 7.26e-3 SMART
ZnF_C2H2 273 295 1.4e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082203
AA Change: Q105K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080837
Gene: ENSMUSG00000074865
AA Change: Q105K

DomainStartEndE-ValueType
Blast:KRAB 1 34 3e-16 BLAST
ZnF_C2H2 101 123 1.04e-3 SMART
ZnF_C2H2 129 149 1.68e1 SMART
ZnF_C2H2 157 179 2.75e-3 SMART
ZnF_C2H2 185 207 1.98e-4 SMART
ZnF_C2H2 213 235 3.21e-4 SMART
ZnF_C2H2 241 263 3.44e-4 SMART
ZnF_C2H2 269 292 4.98e-1 SMART
ZnF_C2H2 298 320 4.87e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000099083
Gene: ENSMUSG00000074865
AA Change: Q137K

DomainStartEndE-ValueType
KRAB 3 65 5.01e-15 SMART
ZnF_C2H2 132 154 1.04e-3 SMART
ZnF_C2H2 160 180 1.68e1 SMART
ZnF_C2H2 188 210 2.75e-3 SMART
ZnF_C2H2 216 238 1.98e-4 SMART
ZnF_C2H2 244 266 3.21e-4 SMART
ZnF_C2H2 272 294 3.44e-4 SMART
ZnF_C2H2 300 322 2.27e-4 SMART
ZnF_C2H2 328 350 3.44e-4 SMART
ZnF_C2H2 356 378 9.22e-5 SMART
ZnF_C2H2 384 406 2.43e-4 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220648
AA Change: Q105K

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000221250
Predicted Effect probably benign
Transcript: ENSMUST00000222429
Predicted Effect probably benign
Transcript: ENSMUST00000222746
AA Change: N116K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222852
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,293,362 V302G Het
A230072I06Rik T C 8: 12,279,689 I48T unknown Het
A430089I19Rik T C 5: 94,303,377 T297A probably benign Het
Ada T A 2: 163,732,355 D127V probably damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd34c T C 9: 89,729,410 R293G possibly damaging Het
Ap2b1 T C 11: 83,339,430 probably null Het
Arhgef16 A G 4: 154,291,067 S157P probably damaging Het
Atp2b1 C T 10: 99,016,968 L1036F probably damaging Het
Ccdc27 A T 4: 154,028,099 I573N probably damaging Het
Cep164 T C 9: 45,773,852 E869G probably benign Het
Colq A T 14: 31,528,335 V381D possibly damaging Het
Drc1 A G 5: 30,359,614 E519G probably benign Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Epg5 C T 18: 77,981,400 Q1157* probably null Het
Eqtn T C 4: 94,923,707 S150G possibly damaging Het
Fam216a G A 5: 122,367,382 H172Y probably damaging Het
Fbxw19 T A 9: 109,494,646 D87V probably damaging Het
Fgr A T 4: 132,995,013 I198F probably damaging Het
Flnc A G 6: 29,444,050 D621G probably benign Het
Flt3 A C 5: 147,354,922 Y573D probably damaging Het
Git2 A T 5: 114,733,235 I603N probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gnb5 T C 9: 75,343,571 F326L probably damaging Het
Grm8 A T 6: 27,760,258 W358R possibly damaging Het
Grrp1 C T 4: 134,251,648 R173H probably damaging Het
Hoxa3 A G 6: 52,172,273 V126A unknown Het
Hras T C 7: 141,192,151 T144A possibly damaging Het
Hyal1 G A 9: 107,578,370 R293H probably damaging Het
Ifnlr1 A G 4: 135,690,608 S49G possibly damaging Het
Ighv8-11 C A 12: 115,567,385 C41F probably benign Het
Jakmip1 A G 5: 37,134,273 T689A probably damaging Het
Kcnb1 T C 2: 167,188,361 H88R probably damaging Het
Kcnt2 T A 1: 140,570,461 M892K probably benign Het
Lrba C A 3: 86,741,466 S2507* probably null Het
Mbp C T 18: 82,554,374 T65I probably damaging Het
Muc2 A T 7: 141,704,201 Y12F Het
Muc4 T A 16: 32,756,575 S80T Het
Muc5ac A G 7: 141,796,254 D579G possibly damaging Het
Muc5b A G 7: 141,864,023 T3569A possibly damaging Het
Myb C T 10: 21,156,374 R36H probably damaging Het
Myo6 T C 9: 80,264,266 probably null Het
Ogfod1 T C 8: 94,037,353 V22A probably benign Het
Orai3 A G 7: 127,774,064 I246V probably damaging Het
Otog A G 7: 46,241,761 M68V probably benign Het
Pcdh20 T A 14: 88,469,153 D237V probably damaging Het
Pcdhb18 T C 18: 37,490,993 F459L probably benign Het
Pik3c2g C T 6: 139,622,072 T62M possibly damaging Het
Plaa T C 4: 94,582,639 Y420C probably damaging Het
Ppp1r9b C T 11: 95,001,942 A656V probably benign Het
Prg4 T A 1: 150,454,945 E659V unknown Het
Prlhr C A 19: 60,467,145 A328S probably benign Het
Prlr A T 15: 10,328,378 D313V probably benign Het
Prune2 C T 19: 17,120,408 T1092I probably damaging Het
Psme4 T A 11: 30,837,334 L1043H probably damaging Het
Ptprr T C 10: 116,251,179 V521A probably benign Het
Rab44 A T 17: 29,148,205 D703V unknown Het
Rpl9-ps1 A T 11: 83,645,085 Y179* probably null Het
Scg3 T A 9: 75,682,050 N107I probably benign Het
Sh3bgrl2 T C 9: 83,548,472 V5A possibly damaging Het
Slc7a12 T C 3: 14,481,449 V218A probably benign Het
Sorcs2 A G 5: 36,027,978 L918P probably damaging Het
Sox1 C A 8: 12,396,686 A109E probably damaging Het
Syne1 T A 10: 5,205,074 M5622L probably benign Het
Syne1 A T 10: 5,343,416 L1305Q probably damaging Het
Tacc2 A T 7: 130,623,154 H523L probably benign Het
Tas1r2 A T 4: 139,669,627 D788V probably benign Het
Tcl1b5 T A 12: 105,176,435 D7E possibly damaging Het
Tesc A G 5: 118,056,601 D159G possibly damaging Het
Tm2d2 G T 8: 25,017,300 probably benign Het
Tnfrsf11a T A 1: 105,809,446 C93S probably damaging Het
Tnfsf4 T C 1: 161,417,022 V94A probably benign Het
Trav13n-3 T A 14: 53,337,507 Y69N probably benign Het
Utp20 T C 10: 88,754,595 D2339G probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r114 G T 17: 23,291,012 Y831* probably null Het
Vmn2r72 T A 7: 85,751,938 N91I probably damaging Het
Zfp846 T C 9: 20,588,512 S13P possibly damaging Het
Other mutations in Zfp934
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1915:Zfp934 UTSW 13 62517955 missense probably damaging 1.00
R1957:Zfp934 UTSW 13 62518294 missense possibly damaging 0.83
R2113:Zfp934 UTSW 13 62518693 missense probably damaging 0.98
R2145:Zfp934 UTSW 13 62517834 missense probably damaging 1.00
R3732:Zfp934 UTSW 13 62517785 missense probably damaging 1.00
R3797:Zfp934 UTSW 13 62517888 missense probably benign
R4326:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4327:Zfp934 UTSW 13 62517559 missense probably benign 0.01
R4909:Zfp934 UTSW 13 62517954 missense probably damaging 1.00
R5236:Zfp934 UTSW 13 62517713 missense probably damaging 1.00
R5237:Zfp934 UTSW 13 62517838 missense probably damaging 1.00
R6305:Zfp934 UTSW 13 62518556 missense probably damaging 0.99
R6729:Zfp934 UTSW 13 62492932 missense probably damaging 1.00
R7072:Zfp934 UTSW 13 62520525 missense probably damaging 0.99
R7186:Zfp934 UTSW 13 62492390 missense probably benign 0.12
R7235:Zfp934 UTSW 13 62518150 missense
R7453:Zfp934 UTSW 13 62518703 missense probably benign 0.40
R7552:Zfp934 UTSW 13 62492891 missense probably damaging 1.00
R7589:Zfp934 UTSW 13 62518316 missense
R7624:Zfp934 UTSW 13 62518524 missense probably benign 0.27
R7780:Zfp934 UTSW 13 62518544 missense possibly damaging 0.92
R7857:Zfp934 UTSW 13 62517547 missense
R7891:Zfp934 UTSW 13 62520189 missense probably benign 0.35
R7974:Zfp934 UTSW 13 62520189 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACATTTGTAGGGTTTCTCTCCAGTATG -3'
(R):5'- GGGTAAAGCTTTCACATGTGC -3'

Sequencing Primer
(F):5'- CCAGTATGTGTTCTTCTATGACTTTG -3'
(R):5'- CCAATTCTCTTCTCAGGTGTGAAAGG -3'
Posted On2019-10-24