Incidental Mutation 'R7651:Prune2'
ID590883
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Nameprune homolog 2
SynonymsA230083H22Rik, 6330414G02Rik, A330102H22Rik
Accession Numbers

Genbank: NM_181348

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7651 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location16956118-17223932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17120408 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1092 (T1092I)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
Predicted Effect probably damaging
Transcript: ENSMUST00000087689
AA Change: T1092I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: T1092I

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik T G 11: 58,293,362 V302G Het
A230072I06Rik T C 8: 12,279,689 I48T unknown Het
A430089I19Rik T C 5: 94,303,377 T297A probably benign Het
Ada T A 2: 163,732,355 D127V probably damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankrd34c T C 9: 89,729,410 R293G possibly damaging Het
Ap2b1 T C 11: 83,339,430 probably null Het
Arhgef16 A G 4: 154,291,067 S157P probably damaging Het
Atp2b1 C T 10: 99,016,968 L1036F probably damaging Het
Ccdc27 A T 4: 154,028,099 I573N probably damaging Het
Cep164 T C 9: 45,773,852 E869G probably benign Het
Colq A T 14: 31,528,335 V381D possibly damaging Het
Drc1 A G 5: 30,359,614 E519G probably benign Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Epg5 C T 18: 77,981,400 Q1157* probably null Het
Eqtn T C 4: 94,923,707 S150G possibly damaging Het
Fam216a G A 5: 122,367,382 H172Y probably damaging Het
Fbxw19 T A 9: 109,494,646 D87V probably damaging Het
Fgr A T 4: 132,995,013 I198F probably damaging Het
Flnc A G 6: 29,444,050 D621G probably benign Het
Flt3 A C 5: 147,354,922 Y573D probably damaging Het
Git2 A T 5: 114,733,235 I603N probably damaging Het
Gm4559 C T 7: 142,273,816 R183K unknown Het
Gnb5 T C 9: 75,343,571 F326L probably damaging Het
Grm8 A T 6: 27,760,258 W358R possibly damaging Het
Grrp1 C T 4: 134,251,648 R173H probably damaging Het
Hoxa3 A G 6: 52,172,273 V126A unknown Het
Hras T C 7: 141,192,151 T144A possibly damaging Het
Hyal1 G A 9: 107,578,370 R293H probably damaging Het
Ifnlr1 A G 4: 135,690,608 S49G possibly damaging Het
Ighv8-11 C A 12: 115,567,385 C41F probably benign Het
Jakmip1 A G 5: 37,134,273 T689A probably damaging Het
Kcnb1 T C 2: 167,188,361 H88R probably damaging Het
Kcnt2 T A 1: 140,570,461 M892K probably benign Het
Lrba C A 3: 86,741,466 S2507* probably null Het
Mbp C T 18: 82,554,374 T65I probably damaging Het
Muc2 A T 7: 141,704,201 Y12F Het
Muc4 T A 16: 32,756,575 S80T Het
Muc5ac A G 7: 141,796,254 D579G possibly damaging Het
Muc5b A G 7: 141,864,023 T3569A possibly damaging Het
Myb C T 10: 21,156,374 R36H probably damaging Het
Myo6 T C 9: 80,264,266 probably null Het
Ogfod1 T C 8: 94,037,353 V22A probably benign Het
Orai3 A G 7: 127,774,064 I246V probably damaging Het
Otog A G 7: 46,241,761 M68V probably benign Het
Pcdh20 T A 14: 88,469,153 D237V probably damaging Het
Pcdhb18 T C 18: 37,490,993 F459L probably benign Het
Pik3c2g C T 6: 139,622,072 T62M possibly damaging Het
Plaa T C 4: 94,582,639 Y420C probably damaging Het
Ppp1r9b C T 11: 95,001,942 A656V probably benign Het
Prg4 T A 1: 150,454,945 E659V unknown Het
Prlhr C A 19: 60,467,145 A328S probably benign Het
Prlr A T 15: 10,328,378 D313V probably benign Het
Psme4 T A 11: 30,837,334 L1043H probably damaging Het
Ptprr T C 10: 116,251,179 V521A probably benign Het
Rab44 A T 17: 29,148,205 D703V unknown Het
Rpl9-ps1 A T 11: 83,645,085 Y179* probably null Het
Scg3 T A 9: 75,682,050 N107I probably benign Het
Sh3bgrl2 T C 9: 83,548,472 V5A possibly damaging Het
Slc7a12 T C 3: 14,481,449 V218A probably benign Het
Sorcs2 A G 5: 36,027,978 L918P probably damaging Het
Sox1 C A 8: 12,396,686 A109E probably damaging Het
Syne1 T A 10: 5,205,074 M5622L probably benign Het
Syne1 A T 10: 5,343,416 L1305Q probably damaging Het
Tacc2 A T 7: 130,623,154 H523L probably benign Het
Tas1r2 A T 4: 139,669,627 D788V probably benign Het
Tcl1b5 T A 12: 105,176,435 D7E possibly damaging Het
Tesc A G 5: 118,056,601 D159G possibly damaging Het
Tm2d2 G T 8: 25,017,300 probably benign Het
Tnfrsf11a T A 1: 105,809,446 C93S probably damaging Het
Tnfsf4 T C 1: 161,417,022 V94A probably benign Het
Trav13n-3 T A 14: 53,337,507 Y69N probably benign Het
Utp20 T C 10: 88,754,595 D2339G probably benign Het
Vmn1r225 A G 17: 20,502,349 I17M possibly damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r114 G T 17: 23,291,012 Y831* probably null Het
Vmn2r72 T A 7: 85,751,938 N91I probably damaging Het
Zfp846 T C 9: 20,588,512 S13P possibly damaging Het
Zfp934 G T 13: 62,518,513 N116K probably benign Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17168344 critical splice donor site probably null
IGL00848:Prune2 APN 19 17119118 missense probably damaging 1.00
IGL00862:Prune2 APN 19 17119349 missense probably benign 0.41
IGL00915:Prune2 APN 19 17016253 missense probably damaging 1.00
IGL01084:Prune2 APN 19 17118209 missense probably benign 0.19
IGL01109:Prune2 APN 19 17123879 missense probably benign 0.03
IGL01372:Prune2 APN 19 17125069 missense probably damaging 1.00
IGL01650:Prune2 APN 19 17168292 missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17123903 missense possibly damaging 0.50
IGL01812:Prune2 APN 19 17003777 missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17118638 missense probably benign 0.00
IGL02195:Prune2 APN 19 17119557 missense probably benign 0.00
IGL02502:Prune2 APN 19 17123881 missense probably benign 0.00
IGL02569:Prune2 APN 19 17178859 missense probably damaging 0.99
IGL02693:Prune2 APN 19 17124491 missense probably benign 0.03
IGL02737:Prune2 APN 19 17193411 nonsense probably null
IGL02794:Prune2 APN 19 17119361 missense probably benign 0.19
IGL02985:Prune2 APN 19 17016359 critical splice donor site probably null
IGL03349:Prune2 APN 19 17123346 missense probably damaging 1.00
3-1:Prune2 UTSW 19 17125282 missense probably benign 0.00
R0060:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17123903 missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17122610 missense probably benign 0.00
R0277:Prune2 UTSW 19 17121389 missense probably damaging 0.99
R0321:Prune2 UTSW 19 17120927 missense possibly damaging 0.78
R0321:Prune2 UTSW 19 17122454 missense probably benign 0.39
R0374:Prune2 UTSW 19 17120910 missense probably benign 0.00
R0380:Prune2 UTSW 19 17124007 missense probably damaging 1.00
R0396:Prune2 UTSW 19 17123080 missense probably benign 0.35
R0408:Prune2 UTSW 19 17122310 missense probably benign 0.00
R0421:Prune2 UTSW 19 17123311 missense probably benign 0.02
R0480:Prune2 UTSW 19 17006792 splice site probably benign
R0531:Prune2 UTSW 19 17006753 missense probably damaging 1.00
R0546:Prune2 UTSW 19 17020666 splice site probably benign
R0554:Prune2 UTSW 19 17125218 nonsense probably null
R0659:Prune2 UTSW 19 17122835 missense probably damaging 1.00
R0699:Prune2 UTSW 19 17123955 missense probably damaging 1.00
R0781:Prune2 UTSW 19 17125222 missense probably benign
R1110:Prune2 UTSW 19 17125222 missense probably benign
R1178:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1181:Prune2 UTSW 19 17123105 missense probably benign 0.22
R1337:Prune2 UTSW 19 17119607 missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17212317 missense probably benign 0.40
R1385:Prune2 UTSW 19 17124948 missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17120651 missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17125010 missense probably benign 0.01
R1756:Prune2 UTSW 19 17123704 missense probably benign 0.01
R1765:Prune2 UTSW 19 17125598 missense probably damaging 1.00
R1782:Prune2 UTSW 19 17122173 missense probably benign 0.00
R1817:Prune2 UTSW 19 17122081 missense probably benign 0.00
R1838:Prune2 UTSW 19 17199878 missense probably damaging 1.00
R1851:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1852:Prune2 UTSW 19 17199139 missense probably damaging 1.00
R1866:Prune2 UTSW 19 17123492 missense probably damaging 1.00
R1911:Prune2 UTSW 19 17113674 missense probably benign 0.02
R1983:Prune2 UTSW 19 17020642 missense probably damaging 0.97
R2014:Prune2 UTSW 19 17120523 missense probably damaging 1.00
R2066:Prune2 UTSW 19 17120678 missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17119745 missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17208238 missense probably damaging 1.00
R2128:Prune2 UTSW 19 17122422 missense probably benign 0.00
R2165:Prune2 UTSW 19 17120182 missense probably benign 0.19
R2241:Prune2 UTSW 19 17123092 missense probably damaging 0.96
R2278:Prune2 UTSW 19 17118555 missense possibly damaging 0.93
R2504:Prune2 UTSW 19 17000036 missense probably damaging 1.00
R2508:Prune2 UTSW 19 17122622 missense probably benign 0.43
R3055:Prune2 UTSW 19 17125043 missense probably damaging 0.98
R3086:Prune2 UTSW 19 17121413 missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3105:Prune2 UTSW 19 17119156 missense probably damaging 1.00
R3547:Prune2 UTSW 19 17124348 missense probably damaging 0.96
R3702:Prune2 UTSW 19 17178871 missense probably damaging 1.00
R3753:Prune2 UTSW 19 17125454 missense probably benign 0.38
R3933:Prune2 UTSW 19 17123954 missense probably damaging 1.00
R3935:Prune2 UTSW 19 17199786 missense probably damaging 1.00
R4022:Prune2 UTSW 19 17000020 missense probably damaging 1.00
R4042:Prune2 UTSW 19 17003826 critical splice donor site probably null
R4164:Prune2 UTSW 19 17003734 missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17121910 missense probably benign 0.00
R4642:Prune2 UTSW 19 17020655 critical splice donor site probably null
R4661:Prune2 UTSW 19 17000023 missense probably damaging 1.00
R4666:Prune2 UTSW 19 17120188 nonsense probably null
R4823:Prune2 UTSW 19 17120504 missense probably damaging 1.00
R4897:Prune2 UTSW 19 17121855 missense probably benign 0.03
R4922:Prune2 UTSW 19 17122752 missense probably benign 0.00
R4962:Prune2 UTSW 19 17122273 missense probably benign 0.11
R5026:Prune2 UTSW 19 17199142 missense probably damaging 1.00
R5042:Prune2 UTSW 19 17119797 missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17199910 missense probably damaging 1.00
R5133:Prune2 UTSW 19 17003631 missense probably damaging 1.00
R5184:Prune2 UTSW 19 17216357 missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5339:Prune2 UTSW 19 17120872 missense probably damaging 1.00
R5363:Prune2 UTSW 19 17118266 missense probably damaging 1.00
R5382:Prune2 UTSW 19 17003659 missense probably damaging 1.00
R5436:Prune2 UTSW 19 17020643 missense probably damaging 1.00
R5480:Prune2 UTSW 19 17120947 missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17118209 missense probably benign 0.19
R5678:Prune2 UTSW 19 17118668 missense probably damaging 1.00
R5814:Prune2 UTSW 19 17016361 splice site probably null
R5894:Prune2 UTSW 19 17121391 missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17118716 missense probably benign 0.35
R6207:Prune2 UTSW 19 17118116 missense probably damaging 1.00
R6218:Prune2 UTSW 19 17121562 missense probably benign 0.00
R6573:Prune2 UTSW 19 17121157 missense probably damaging 1.00
R6573:Prune2 UTSW 19 17121158 missense possibly damaging 0.61
R6734:Prune2 UTSW 19 17003733 missense probably damaging 1.00
R6805:Prune2 UTSW 19 17120590 missense probably benign
R6837:Prune2 UTSW 19 17178928 missense probably damaging 1.00
R6850:Prune2 UTSW 19 17122188 missense probably benign 0.00
R6858:Prune2 UTSW 19 17118106 missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17123228 missense probably damaging 1.00
R6954:Prune2 UTSW 19 17000021 missense probably damaging 1.00
R7098:Prune2 UTSW 19 17120602 missense probably benign 0.39
R7102:Prune2 UTSW 19 17121213 missense probably benign 0.24
R7246:Prune2 UTSW 19 17121368 missense probably damaging 0.99
R7284:Prune2 UTSW 19 17119886 missense probably damaging 1.00
R7295:Prune2 UTSW 19 17119897 missense probably benign 0.01
R7371:Prune2 UTSW 19 17119370 missense probably benign 0.02
R7830:Prune2 UTSW 19 17122674 missense probably benign 0.21
R7872:Prune2 UTSW 19 17119434 missense probably benign 0.05
R7881:Prune2 UTSW 19 17123029 missense possibly damaging 0.50
R7955:Prune2 UTSW 19 17119434 missense probably benign 0.05
R7964:Prune2 UTSW 19 17123029 missense possibly damaging 0.50
X0019:Prune2 UTSW 19 17121517 missense probably benign 0.16
X0028:Prune2 UTSW 19 17122885 missense probably damaging 1.00
X0064:Prune2 UTSW 19 17122375 missense probably damaging 1.00
X0066:Prune2 UTSW 19 17118790 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTGCCTCACACAGAAG -3'
(R):5'- GAACCGGGTTTCAGGTTCAC -3'

Sequencing Primer
(F):5'- GGCATTGCCTCACACAGAAGATAAG -3'
(R):5'- AGGTTCACTGTTTGCAGCTATGTAAC -3'
Posted On2019-10-24