Incidental Mutation 'R7652:Trpc3'
ID590893
Institutional Source Beutler Lab
Gene Symbol Trpc3
Ensembl Gene ENSMUSG00000027716
Gene Nametransient receptor potential cation channel, subfamily C, member 3
SynonymsTrp3, Trrp3, Trcp3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7652 (G1)
Quality Score189.009
Status Not validated
Chromosome3
Chromosomal Location36620482-36690167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36638528 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 772 (V772F)
Ref Sequence ENSEMBL: ENSMUSP00000029271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029271]
Predicted Effect probably benign
Transcript: ENSMUST00000029271
AA Change: V772F

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029271
Gene: ENSMUSG00000027716
AA Change: V772F

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 47 68 N/A INTRINSIC
ANK 100 129 2.47e2 SMART
ANK 135 163 1.97e1 SMART
ANK 221 250 1.13e1 SMART
Pfam:TRP_2 256 318 3e-28 PFAM
transmembrane domain 414 433 N/A INTRINSIC
Pfam:Ion_trans 443 744 4.4e-34 PFAM
Pfam:PKD_channel 486 739 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous knockout mice or mice heterozygoous for a point mutation in exon 7 display an abnormal gait. Abnormal nervous system electrophysiology is also described. An A1903G point mutation in exon 7 results in homozygous lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Trpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Trpc3 APN 3 36640639 missense possibly damaging 0.95
IGL01701:Trpc3 APN 3 36671594 missense possibly damaging 0.92
IGL02254:Trpc3 APN 3 36651520 missense probably null 0.98
IGL02723:Trpc3 APN 3 36650228 missense probably benign 0.02
IGL02816:Trpc3 APN 3 36651702 missense probably damaging 1.00
IGL02867:Trpc3 APN 3 36640701 missense probably benign 0.10
IGL02929:Trpc3 APN 3 36638474 nonsense probably null
IGL03076:Trpc3 APN 3 36640655 missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36644256 missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36644256 missense probably damaging 1.00
R0115:Trpc3 UTSW 3 36624417 missense probably benign 0.05
R0481:Trpc3 UTSW 3 36624417 missense probably benign 0.05
R0645:Trpc3 UTSW 3 36671505 missense probably benign 0.00
R0694:Trpc3 UTSW 3 36671555 missense possibly damaging 0.48
R1190:Trpc3 UTSW 3 36671348 missense probably benign 0.00
R1635:Trpc3 UTSW 3 36640627 missense probably damaging 1.00
R1828:Trpc3 UTSW 3 36638546 missense possibly damaging 0.95
R2204:Trpc3 UTSW 3 36650149 missense possibly damaging 0.79
R2937:Trpc3 UTSW 3 36634383 nonsense probably null
R3732:Trpc3 UTSW 3 36638559 missense probably benign
R3732:Trpc3 UTSW 3 36638559 missense probably benign
R3733:Trpc3 UTSW 3 36638559 missense probably benign
R4063:Trpc3 UTSW 3 36671023 missense probably damaging 1.00
R4270:Trpc3 UTSW 3 36662925 nonsense probably null
R4807:Trpc3 UTSW 3 36634382 missense probably benign 0.00
R4996:Trpc3 UTSW 3 36662818 missense probably benign 0.00
R5098:Trpc3 UTSW 3 36662898 missense probably benign 0.07
R5139:Trpc3 UTSW 3 36671557 missense possibly damaging 0.46
R5251:Trpc3 UTSW 3 36670954 missense probably damaging 1.00
R5337:Trpc3 UTSW 3 36638370 intron probably benign
R5891:Trpc3 UTSW 3 36671022 missense probably damaging 1.00
R6512:Trpc3 UTSW 3 36662758 missense possibly damaging 0.59
R6618:Trpc3 UTSW 3 36640695 missense possibly damaging 0.82
R6750:Trpc3 UTSW 3 36624393 missense probably damaging 1.00
R6950:Trpc3 UTSW 3 36638590 missense probably damaging 1.00
R6986:Trpc3 UTSW 3 36655016 critical splice donor site probably null
R7031:Trpc3 UTSW 3 36621310 missense probably benign
R7100:Trpc3 UTSW 3 36650067 missense probably benign 0.00
R7182:Trpc3 UTSW 3 36655109 missense probably benign 0.02
R7211:Trpc3 UTSW 3 36640733 missense possibly damaging 0.81
R7214:Trpc3 UTSW 3 36650137 missense possibly damaging 0.94
R7284:Trpc3 UTSW 3 36624413 missense probably damaging 0.98
R7468:Trpc3 UTSW 3 36624416 missense probably damaging 0.99
R7815:Trpc3 UTSW 3 36655145 missense probably benign 0.28
R7833:Trpc3 UTSW 3 36640672 missense probably damaging 0.96
R7916:Trpc3 UTSW 3 36640672 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTCTTCTAAGTTCACACACGG -3'
(R):5'- ACATCAGGTCTGGAGTGTCTTG -3'

Sequencing Primer
(F):5'- GTTCACACACGGAAATTAATGAAC -3'
(R):5'- GGAAGTTTGCTCGTTCCA -3'
Posted On2019-10-24