Incidental Mutation 'R7652:Rnf13'
ID590894
Institutional Source Beutler Lab
Gene Symbol Rnf13
Ensembl Gene ENSMUSG00000036503
Gene Namering finger protein 13
Synonyms2010001H16Rik, Rzf
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location57736062-57835233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57764351 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 28 (N28S)
Ref Sequence ENSEMBL: ENSMUSP00000049331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041826] [ENSMUST00000197205] [ENSMUST00000198214] [ENSMUST00000198249] [ENSMUST00000198510] [ENSMUST00000199041] [ENSMUST00000200497] [ENSMUST00000200600]
Predicted Effect probably benign
Transcript: ENSMUST00000041826
AA Change: N28S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000049331
Gene: ENSMUSG00000036503
AA Change: N28S

DomainStartEndE-ValueType
Pfam:PA 63 160 1.3e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
RING 240 281 1.85e-8 SMART
low complexity region 291 299 N/A INTRINSIC
low complexity region 336 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197205
AA Change: N28S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143692
Gene: ENSMUSG00000036503
AA Change: N28S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:PA 62 153 2.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198214
AA Change: N28S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143498
Gene: ENSMUSG00000036503
AA Change: N28S

DomainStartEndE-ValueType
Pfam:PA 63 160 5.1e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
low complexity region 208 226 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198249
AA Change: N28S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142828
Gene: ENSMUSG00000036503
AA Change: N28S

DomainStartEndE-ValueType
Pfam:PA 33 131 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198510
AA Change: N28S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142451
Gene: ENSMUSG00000036503
AA Change: N28S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199041
AA Change: N28S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142335
Gene: ENSMUSG00000036503
AA Change: N28S

DomainStartEndE-ValueType
Pfam:PA 59 162 6.6e-15 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 2e-7 SMART
Blast:RING 240 267 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000200497
AA Change: N28S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142462
Gene: ENSMUSG00000036503
AA Change: N28S

DomainStartEndE-ValueType
Pfam:PA 59 162 1.1e-14 PFAM
transmembrane domain 182 204 N/A INTRINSIC
SCOP:d1ldjb_ 211 260 1e-7 SMART
Blast:RING 240 261 9e-8 BLAST
low complexity region 262 270 N/A INTRINSIC
low complexity region 307 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200600
AA Change: N28S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142594
Gene: ENSMUSG00000036503
AA Change: N28S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the PA-TM-RING family of proteins that contain a protease associated (PA) domain and a RING finger domain separated by a transmembrane (TM) domain. The encoded protein is an E3 ubiquitin ligase localized to the endosomal-lysosomal vesicles and inner nuclear membrane. Mice lacking the encoded protein have impaired learning abilities associated with a decreased synaptic vesicle density and dysregulated SNARE complex assembly. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on the X chromosome. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Rnf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Rnf13 APN 3 57807087 missense probably benign 0.06
IGL01835:Rnf13 APN 3 57820586 missense probably damaging 1.00
IGL02219:Rnf13 APN 3 57796223 missense probably damaging 1.00
IGL02675:Rnf13 APN 3 57779396 missense probably benign 0.17
IGL03015:Rnf13 APN 3 57833744 missense possibly damaging 0.74
IGL03246:Rnf13 APN 3 57769050 missense probably damaging 0.98
R0147:Rnf13 UTSW 3 57802468 missense probably damaging 0.98
R0481:Rnf13 UTSW 3 57779451 missense probably damaging 1.00
R0481:Rnf13 UTSW 3 57807053 missense probably damaging 1.00
R1389:Rnf13 UTSW 3 57779496 missense probably damaging 1.00
R2146:Rnf13 UTSW 3 57802486 missense probably null 0.99
R3964:Rnf13 UTSW 3 57769112 missense probably damaging 0.96
R4444:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4446:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4489:Rnf13 UTSW 3 57820589 missense probably damaging 1.00
R4810:Rnf13 UTSW 3 57796272 missense probably damaging 0.99
R4940:Rnf13 UTSW 3 57796206 missense probably damaging 0.98
R6233:Rnf13 UTSW 3 57832970 missense possibly damaging 0.83
R7002:Rnf13 UTSW 3 57833612 missense probably damaging 0.96
R7622:Rnf13 UTSW 3 57820534 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGTCCGGTGATTTGAAATACC -3'
(R):5'- AAGTAAAACTGTGTTGTTTGGCATG -3'

Sequencing Primer
(F):5'- CAATGCCTGGCTTCCAAATATG -3'
(R):5'- TCATGTAGAGACTTGATGCCCCAG -3'
Posted On2019-10-24