Incidental Mutation 'R7652:Dnajc6'
ID590899
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene NameDnaJ heat shock protein family (Hsp40) member C6
Synonymsauxilin, 2810027M23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101496648-101642799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101606677 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 209 (Q209L)
Ref Sequence ENSEMBL: ENSMUSP00000102546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933] [ENSMUST00000149047] [ENSMUST00000154120]
Predicted Effect probably damaging
Transcript: ENSMUST00000038207
AA Change: Q179L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: Q179L

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094953
AA Change: Q141L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: Q141L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106929
AA Change: Q141L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: Q141L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106930
AA Change: Q141L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: Q141L

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106933
AA Change: Q209L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: Q209L

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149047
AA Change: Q141L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119542
Gene: ENSMUSG00000028528
AA Change: Q141L

DomainStartEndE-ValueType
PDB:3N0A|A 30 194 1e-118 PDB
SCOP:d1d5ra2 50 187 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154120
SMART Domains Protein: ENSMUSP00000114840
Gene: ENSMUSG00000028528

DomainStartEndE-ValueType
PDB:3N0A|A 30 116 4e-54 PDB
SCOP:d1d5ra2 50 101 1e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101508089 intron probably benign
IGL02336:Dnajc6 APN 4 101614286 unclassified probably null
IGL02551:Dnajc6 APN 4 101639353 missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101597813 missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101639300 missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101616860 missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101508077 intron probably benign
R0091:Dnajc6 UTSW 4 101616777 splice site probably benign
R0384:Dnajc6 UTSW 4 101598956 missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101635191 missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101611253 missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101635116 missense probably damaging 0.98
R1421:Dnajc6 UTSW 4 101611316 missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101639347 missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101599137 missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101599167 missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101597831 missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101598988 missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101614238 missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101612930 missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101616857 missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101639396 missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101550799 missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101599034 intron probably benign
R4938:Dnajc6 UTSW 4 101636813 missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101615627 missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101628158 critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101606610 missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101618642 missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101616577 missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101597807 missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101615598 missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101635065 nonsense probably null
R6956:Dnajc6 UTSW 4 101614273 missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101615615 missense probably damaging 1.00
R7155:Dnajc6 UTSW 4 101612945 missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101597803 missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101639372 missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101606611 missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101597926 missense probably benign 0.40
R7622:Dnajc6 UTSW 4 101640491 missense probably damaging 1.00
R7789:Dnajc6 UTSW 4 101618532 missense possibly damaging 0.82
Z1088:Dnajc6 UTSW 4 101639329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGAGACGACAGGATACC -3'
(R):5'- TCTTTAGGGGATTAGGGAGGGAA -3'

Sequencing Primer
(F):5'- GAGAGACGACAGGATACCACTTC -3'
(R):5'- GGATTAGGGAGGGAAAGGCC -3'
Posted On2019-10-24