Incidental Mutation 'R7652:Agrn'
ID590901
Institutional Source Beutler Lab
Gene Symbol Agrn
Ensembl Gene ENSMUSG00000041936
Gene Nameagrin
SynonymsNMF380, Agrin, nmf380
Accession Numbers

Genbank: NM_021604; MGI: 87961

Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location156165290-156197488 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 156169218 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]
Predicted Effect probably benign
Transcript: ENSMUST00000071248
SMART Domains Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1139 5.57e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105574
SMART Domains Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1678 6.51e-36 SMART
EGF 1699 1735 4.35e-6 SMART
LamG 1771 1907 5.01e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105575
SMART Domains Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1682 9.2e-36 SMART
EGF 1703 1739 4.35e-6 SMART
LamG 1794 1930 5.01e-37 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180572
SMART Domains Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NtA 32 159 5.1e-91 PFAM
FOLN 173 198 8.25e-6 SMART
KAZAL 198 244 1.22e-17 SMART
FOLN 249 273 7.58e-5 SMART
EGF_like 249 288 7.38e1 SMART
KAZAL 273 319 1.51e-13 SMART
KAZAL 348 391 1.8e-6 SMART
KAZAL 417 463 1.55e-10 SMART
FOLN 469 491 8.25e-6 SMART
KAZAL 491 536 1.14e-17 SMART
KAZAL 556 601 6.43e-17 SMART
FOLN 603 626 2.94e-2 SMART
KAZAL 614 666 8.96e-16 SMART
low complexity region 672 679 N/A INTRINSIC
KAZAL 706 752 1.12e-16 SMART
EGF_Lam 795 846 3.29e-15 SMART
EGF_Lam 849 893 6.7e-7 SMART
FOLN 902 924 1.94e-2 SMART
KAZAL 924 971 3.9e-16 SMART
low complexity region 996 1013 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
SEA 1121 1243 2.26e-35 SMART
low complexity region 1249 1276 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
EGF 1321 1356 1.49e-4 SMART
LamG 1381 1517 4e-45 SMART
EGF 1541 1575 2.23e-3 SMART
EGF 1580 1614 7.13e-2 SMART
LamG 1649 1785 6.51e-36 SMART
EGF 1806 1842 4.35e-6 SMART
LamG 1878 2014 5.01e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Agrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Agrn APN 4 156170572 splice site probably benign
IGL00811:Agrn APN 4 156168774 missense possibly damaging 0.70
IGL01066:Agrn APN 4 156177343 missense probably benign 0.00
IGL01412:Agrn APN 4 156171034 splice site probably benign
IGL01414:Agrn APN 4 156195239 splice site probably null
IGL02075:Agrn APN 4 156170210 missense probably benign 0.40
IGL02609:Agrn APN 4 156175223 splice site probably benign
IGL02669:Agrn APN 4 156174561 splice site probably benign
IGL02671:Agrn APN 4 156174561 splice site probably benign
IGL02672:Agrn APN 4 156174561 splice site probably benign
IGL02674:Agrn APN 4 156174561 splice site probably benign
IGL02724:Agrn APN 4 156172807 nonsense probably null
IGL02804:Agrn APN 4 156174055 missense probably benign 0.00
IGL02986:Agrn APN 4 156178854 missense possibly damaging 0.84
IGL03160:Agrn APN 4 156170363 missense probably damaging 0.98
F6893:Agrn UTSW 4 156174179 missense probably benign
R0092:Agrn UTSW 4 156178953 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0482:Agrn UTSW 4 156173555 missense probably damaging 0.98
R0531:Agrn UTSW 4 156179434 missense probably benign 0.38
R0536:Agrn UTSW 4 156179553 missense probably benign 0.01
R0690:Agrn UTSW 4 156174453 missense probably damaging 1.00
R0750:Agrn UTSW 4 156166937 nonsense probably null
R1079:Agrn UTSW 4 156177225 missense probably damaging 1.00
R1199:Agrn UTSW 4 156172299 missense probably benign 0.00
R1222:Agrn UTSW 4 156177385 missense probably damaging 0.99
R1534:Agrn UTSW 4 156176684 missense probably damaging 1.00
R1587:Agrn UTSW 4 156179440 missense probably damaging 0.99
R1625:Agrn UTSW 4 156172860 missense probably damaging 1.00
R1698:Agrn UTSW 4 156166558 missense probably benign 0.03
R1717:Agrn UTSW 4 156166519 frame shift probably null
R1718:Agrn UTSW 4 156166519 frame shift probably null
R1721:Agrn UTSW 4 156175173 nonsense probably null
R1765:Agrn UTSW 4 156176827 nonsense probably null
R1840:Agrn UTSW 4 156167415 missense probably damaging 1.00
R1865:Agrn UTSW 4 156166519 frame shift probably null
R2105:Agrn UTSW 4 156177299 nonsense probably null
R2265:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2266:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2269:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2382:Agrn UTSW 4 156176516 missense probably damaging 0.97
R2497:Agrn UTSW 4 156173811 missense probably benign 0.28
R2509:Agrn UTSW 4 156166424 utr 3 prime probably null
R2510:Agrn UTSW 4 156166424 utr 3 prime probably null
R2511:Agrn UTSW 4 156166424 utr 3 prime probably null
R2994:Agrn UTSW 4 156167328 missense possibly damaging 0.79
R3824:Agrn UTSW 4 156169302 missense probably damaging 1.00
R4736:Agrn UTSW 4 156172401 missense probably benign 0.38
R4755:Agrn UTSW 4 156173522 intron probably benign
R4853:Agrn UTSW 4 156185550 critical splice donor site probably null
R4878:Agrn UTSW 4 156170845 missense probably damaging 1.00
R5117:Agrn UTSW 4 156185553 missense probably benign 0.30
R5228:Agrn UTSW 4 156166946 missense probably damaging 1.00
R5236:Agrn UTSW 4 156178858 missense possibly damaging 0.93
R5269:Agrn UTSW 4 156168990 missense probably benign 0.10
R5282:Agrn UTSW 4 156173035 missense probably damaging 1.00
R5449:Agrn UTSW 4 156167280 critical splice donor site probably null
R5560:Agrn UTSW 4 156178497 missense probably damaging 0.99
R5668:Agrn UTSW 4 156167313 missense probably damaging 0.97
R5725:Agrn UTSW 4 156173875 missense probably benign 0.25
R5967:Agrn UTSW 4 156175103 missense probably damaging 1.00
R6226:Agrn UTSW 4 156173609 missense probably damaging 0.96
R6338:Agrn UTSW 4 156170585 missense probably benign 0.17
R6351:Agrn UTSW 4 156179434 missense probably benign 0.00
R6437:Agrn UTSW 4 156176778 missense probably damaging 0.96
R6490:Agrn UTSW 4 156167362 nonsense probably null
R6909:Agrn UTSW 4 156177007 missense possibly damaging 0.90
R7110:Agrn UTSW 4 156178875 missense possibly damaging 0.88
R7123:Agrn UTSW 4 156172840 missense probably benign
R7163:Agrn UTSW 4 156178509 missense probably damaging 1.00
R7180:Agrn UTSW 4 156171839 missense probably benign 0.00
R7251:Agrn UTSW 4 156174606 missense probably damaging 1.00
R7289:Agrn UTSW 4 156178932 missense probably damaging 1.00
R7335:Agrn UTSW 4 156176532 missense probably damaging 1.00
R7336:Agrn UTSW 4 156174914 nonsense probably null
R7406:Agrn UTSW 4 156172301 missense possibly damaging 0.93
R7460:Agrn UTSW 4 156174424 missense probably damaging 0.98
R7531:Agrn UTSW 4 156169804 missense probably damaging 1.00
R7585:Agrn UTSW 4 156170674 missense probably benign 0.08
R7646:Agrn UTSW 4 156195354 missense probably damaging 0.99
R7714:Agrn UTSW 4 156195397 missense probably damaging 1.00
R7751:Agrn UTSW 4 156176429 missense probably damaging 1.00
R7852:Agrn UTSW 4 156169057 missense probably benign 0.01
R7935:Agrn UTSW 4 156169057 missense probably benign 0.01
R8039:Agrn UTSW 4 156169011 missense not run
R8056:Agrn UTSW 4 156170411 missense not run
R8061:Agrn UTSW 4 156178954 missense not run
Z1177:Agrn UTSW 4 156171544 nonsense probably null
Z1177:Agrn UTSW 4 156179576 missense not run
Predicted Primers PCR Primer
(F):5'- AACACATGCTCCTGAGTCAG -3'
(R):5'- CGTGGGATTAATACTGCCTCC -3'

Sequencing Primer
(F):5'- AGCAGCTGATGGCCTCTTAGAG -3'
(R):5'- GCAATTGGGCATACTCCAGC -3'
Posted On2019-10-24