Incidental Mutation 'R7652:Ugt2b35'
ID590905
Institutional Source Beutler Lab
Gene Symbol Ugt2b35
Ensembl Gene ENSMUSG00000035811
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B35
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location87000860-87013275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87001510 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 207 (F207I)
Ref Sequence ENSEMBL: ENSMUSP00000031186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031186]
Predicted Effect probably damaging
Transcript: ENSMUST00000031186
AA Change: F207I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031186
Gene: ENSMUSG00000035811
AA Change: F207I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 526 1e-253 PFAM
Pfam:Glyco_tran_28_C 338 449 1.9e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Ugt2b35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ugt2b35 APN 5 87008192 missense probably benign 0.00
IGL01109:Ugt2b35 APN 5 87008306 missense probably damaging 1.00
IGL01586:Ugt2b35 APN 5 87011391 missense probably benign 0.07
IGL02151:Ugt2b35 APN 5 87003282 missense possibly damaging 0.65
IGL02225:Ugt2b35 APN 5 87007405 splice site probably benign
IGL02483:Ugt2b35 APN 5 87001145 missense possibly damaging 0.87
IGL02504:Ugt2b35 APN 5 87001541 missense possibly damaging 0.50
IGL02690:Ugt2b35 APN 5 87001237 missense probably benign 0.01
IGL02954:Ugt2b35 APN 5 87011321 missense probably benign 0.00
IGL03242:Ugt2b35 APN 5 87007395 missense probably damaging 1.00
R0329:Ugt2b35 UTSW 5 87003405 missense probably null 0.38
R0513:Ugt2b35 UTSW 5 87003412 splice site probably benign
R0571:Ugt2b35 UTSW 5 87000934 missense possibly damaging 0.51
R0827:Ugt2b35 UTSW 5 87008130 splice site probably benign
R1396:Ugt2b35 UTSW 5 87011530 missense possibly damaging 0.56
R1437:Ugt2b35 UTSW 5 87001031 missense probably benign 0.02
R1557:Ugt2b35 UTSW 5 87007297 splice site probably null
R1869:Ugt2b35 UTSW 5 87001288 missense probably damaging 1.00
R1937:Ugt2b35 UTSW 5 87001282 missense probably damaging 1.00
R2067:Ugt2b35 UTSW 5 87001553 missense probably damaging 1.00
R2219:Ugt2b35 UTSW 5 87003332 missense possibly damaging 0.81
R3055:Ugt2b35 UTSW 5 87001598 missense probably benign 0.05
R3793:Ugt2b35 UTSW 5 87001606 missense probably benign 0.15
R4452:Ugt2b35 UTSW 5 87003378 missense probably damaging 0.99
R4548:Ugt2b35 UTSW 5 87008275 nonsense probably null
R4902:Ugt2b35 UTSW 5 87003300 missense possibly damaging 0.89
R5311:Ugt2b35 UTSW 5 87011280 nonsense probably null
R6187:Ugt2b35 UTSW 5 87007322 missense probably damaging 0.98
R6332:Ugt2b35 UTSW 5 87001556 missense probably damaging 1.00
R6719:Ugt2b35 UTSW 5 87007388 missense probably damaging 1.00
R7211:Ugt2b35 UTSW 5 87001318 missense probably benign 0.39
R7766:Ugt2b35 UTSW 5 87001202 missense possibly damaging 0.94
R7825:Ugt2b35 UTSW 5 87001359 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTAGATGCCATGGCTTCCTG -3'
(R):5'- CAGGACTGATACCTTCTATTTGAAC -3'

Sequencing Primer
(F):5'- CTTCCTGTGGGGAGCTCATAGC -3'
(R):5'- TGAGCTTTTACAGAGCATTCATG -3'
Posted On2019-10-24