Incidental Mutation 'R7652:Apoe'
ID590912
Institutional Source Beutler Lab
Gene Symbol Apoe
Ensembl Gene ENSMUSG00000002985
Gene Nameapolipoprotein E
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19696109-19699188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19696610 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 236 (R236S)
Ref Sequence ENSEMBL: ENSMUSP00000133302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003066] [ENSMUST00000032555] [ENSMUST00000045035] [ENSMUST00000093552] [ENSMUST00000108451] [ENSMUST00000172808] [ENSMUST00000172983] [ENSMUST00000173739] [ENSMUST00000174064] [ENSMUST00000174144] [ENSMUST00000174191] [ENSMUST00000174355] [ENSMUST00000174710] [ENSMUST00000207978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003066
AA Change: R236S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003066
Gene: ENSMUSG00000002985
AA Change: R236S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032555
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045035
SMART Domains Protein: ENSMUSP00000045571
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 1.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093552
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108451
SMART Domains Protein: ENSMUSP00000104091
Gene: ENSMUSG00000040564

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ApoC-I 27 87 3.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172808
SMART Domains Protein: ENSMUSP00000134558
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Apolipoprotein 61 146 8.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172983
SMART Domains Protein: ENSMUSP00000133359
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173739
AA Change: R236S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133371
Gene: ENSMUSG00000002985
AA Change: R236S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174064
AA Change: R236S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133302
Gene: ENSMUSG00000002985
AA Change: R236S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 73 284 2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174144
SMART Domains Protein: ENSMUSP00000134622
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174191
SMART Domains Protein: ENSMUSP00000133447
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174355
AA Change: R236S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134160
Gene: ENSMUSG00000002985
AA Change: R236S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174710
SMART Domains Protein: ENSMUSP00000134429
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207978
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mutations at this locus cause diet-induced hypercholesterolemia and atherosclerosis. Homozygous null mutants also develop foam-cell rich deposits in proximal aorta, impaired blood-nerve and blood-brain barriers, and many xanthomatous lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Apoe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Apoe APN 7 19696600 missense probably damaging 1.00
IGL03324:Apoe APN 7 19696537 missense probably benign 0.05
R0008:Apoe UTSW 7 19697080 missense probably damaging 0.99
R2860:Apoe UTSW 7 19697554 missense probably damaging 1.00
R2861:Apoe UTSW 7 19697554 missense probably damaging 1.00
R2862:Apoe UTSW 7 19697554 missense probably damaging 1.00
R3919:Apoe UTSW 7 19696547 missense probably benign 0.00
R4583:Apoe UTSW 7 19697498 missense possibly damaging 0.66
R4756:Apoe UTSW 7 19696921 missense probably benign 0.20
R5027:Apoe UTSW 7 19697015 missense probably damaging 1.00
R6188:Apoe UTSW 7 19698380 intron probably benign
R6464:Apoe UTSW 7 19697536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGGGGTTGGTAGCCAC -3'
(R):5'- CCTAGCTGTGTACAAGGCAG -3'

Sequencing Primer
(F):5'- AGAGGCCTGTATCTTCTCCATCAG -3'
(R):5'- TGTGTACAAGGCAGGGGCAC -3'
Posted On2019-10-24