Incidental Mutation 'R7652:Kri1'
ID590922
Institutional Source Beutler Lab
Gene Symbol Kri1
Ensembl Gene ENSMUSG00000035047
Gene NameKRI1 homolog
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7652 (G1)
Quality Score119.467
Status Not validated
Chromosome9
Chromosomal Location21273457-21287969 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC to TTCCTCCTCCTCCTCCTCCTCCTCCTC at 21281056 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038671] [ENSMUST00000065005] [ENSMUST00000184326]
Predicted Effect probably benign
Transcript: ENSMUST00000038671
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065005
SMART Domains Protein: ENSMUSP00000068450
Gene: ENSMUSG00000002820

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Peptidase_C54 109 411 5.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184326
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Kri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Kri1 APN 9 21280427 missense probably damaging 1.00
IGL02272:Kri1 APN 9 21276168 missense probably damaging 1.00
IGL03229:Kri1 APN 9 21282070 missense probably damaging 1.00
FR4548:Kri1 UTSW 9 21281050 small deletion probably benign
R0040:Kri1 UTSW 9 21281105 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0284:Kri1 UTSW 9 21276552 splice site probably benign
R0665:Kri1 UTSW 9 21281640 intron probably benign
R1632:Kri1 UTSW 9 21282211 missense possibly damaging 0.89
R1640:Kri1 UTSW 9 21280457 missense possibly damaging 0.61
R1847:Kri1 UTSW 9 21280492 splice site probably benign
R3154:Kri1 UTSW 9 21281894 missense possibly damaging 0.51
R4222:Kri1 UTSW 9 21281063 missense probably benign 0.00
R4572:Kri1 UTSW 9 21280384 missense probably damaging 1.00
R4905:Kri1 UTSW 9 21287702 missense probably benign 0.19
R5236:Kri1 UTSW 9 21275941 missense probably damaging 1.00
R5539:Kri1 UTSW 9 21279372 nonsense probably null
R5696:Kri1 UTSW 9 21280237 missense probably damaging 1.00
R5701:Kri1 UTSW 9 21281129 missense possibly damaging 0.89
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6991:Kri1 UTSW 9 21287754 unclassified probably benign
R6994:Kri1 UTSW 9 21287787 unclassified probably benign
R7095:Kri1 UTSW 9 21279432 missense
R7339:Kri1 UTSW 9 21286587 missense
R7787:Kri1 UTSW 9 21281084 missense
R7908:Kri1 UTSW 9 21281056 small deletion probably benign
RF027:Kri1 UTSW 9 21281068 frame shift probably null
RF028:Kri1 UTSW 9 21281071 frame shift probably null
RF058:Kri1 UTSW 9 21281066 frame shift probably null
Z1088:Kri1 UTSW 9 21274122 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTGCAAAGAGGTGAATGTAATG -3'
(R):5'- ATCCCAGGCTATCTCTGTGC -3'

Sequencing Primer
(F):5'- TTTGAACATCGGACCTTCGGAAG -3'
(R):5'- TCTGTGCCCCTCACCAGG -3'
Posted On2019-10-24