Incidental Mutation 'R7652:Olfr814'
ID590929
Institutional Source Beutler Lab
Gene Symbol Olfr814
Ensembl Gene ENSMUSG00000059134
Gene Nameolfactory receptor 814
SynonymsMOR113-5, MOR113-8, GA_x6K02T2PULF-11553313-11552381
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129871473-129879851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129874477 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 93 (N93K)
Ref Sequence ENSEMBL: ENSMUSP00000150716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081367] [ENSMUST00000213742] [ENSMUST00000216966]
Predicted Effect probably damaging
Transcript: ENSMUST00000081367
AA Change: N93K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080106
Gene: ENSMUSG00000059134
AA Change: N93K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213742
AA Change: N93K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216966
AA Change: N93K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Olfr814
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Olfr814 APN 10 129874031 missense probably damaging 1.00
IGL02045:Olfr814 APN 10 129874222 missense probably benign 0.22
IGL02301:Olfr814 APN 10 129874079 missense probably damaging 0.99
R0277:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0281:Olfr814 UTSW 10 129874546 missense possibly damaging 0.88
R0323:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0394:Olfr814 UTSW 10 129873942 missense probably benign 0.29
R0546:Olfr814 UTSW 10 129874538 missense possibly damaging 0.94
R3813:Olfr814 UTSW 10 129873986 missense probably damaging 1.00
R4086:Olfr814 UTSW 10 129874298 missense possibly damaging 0.49
R4415:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4416:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4453:Olfr814 UTSW 10 129874661 missense probably null 0.30
R5194:Olfr814 UTSW 10 129874098 missense probably benign 0.00
R5306:Olfr814 UTSW 10 129873941 missense probably damaging 0.97
R5362:Olfr814 UTSW 10 129874553 missense probably damaging 1.00
R5609:Olfr814 UTSW 10 129874738 missense probably benign 0.01
R5987:Olfr814 UTSW 10 129874521 missense probably damaging 0.98
R6240:Olfr814 UTSW 10 129874677 missense probably benign
R6896:Olfr814 UTSW 10 129874754 start codon destroyed probably null 0.98
R7432:Olfr814 UTSW 10 129873850 missense probably benign
R7489:Olfr814 UTSW 10 129874682 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAATAATCAGTGGTGGG -3'
(R):5'- AGACAATCCTCAGTTACAGACTCTG -3'

Sequencing Primer
(F):5'- GGAAAATAACCAGGAATCCAGTTAC -3'
(R):5'- AAATTACTTGCTGAGTATGCTAGGG -3'
Posted On2019-10-24