Incidental Mutation 'R7652:Zfp729b'
ID590939
Institutional Source Beutler Lab
Gene Symbol Zfp729b
Ensembl Gene ENSMUSG00000058093
Gene Namezinc finger protein 729b
SynonymsAA987161
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67589439-67609707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67591252 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 965 (T965A)
Ref Sequence ENSEMBL: ENSMUSP00000012873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012873] [ENSMUST00000138725] [ENSMUST00000224814] [ENSMUST00000225627]
Predicted Effect probably benign
Transcript: ENSMUST00000012873
AA Change: T965A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000012873
Gene: ENSMUSG00000058093
AA Change: T965A

DomainStartEndE-ValueType
KRAB 5 65 1.63e-28 SMART
ZnF_C2H2 132 154 3.58e-2 SMART
PHD 133 194 1e1 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
ZnF_C2H2 188 210 6.78e-3 SMART
ZnF_C2H2 216 238 3.16e-3 SMART
PHD 217 278 7.77e0 SMART
ZnF_C2H2 244 266 6.67e-2 SMART
ZnF_C2H2 272 294 1.12e-3 SMART
ZnF_C2H2 300 322 1.79e-2 SMART
PHD 301 362 1.65e1 SMART
ZnF_C2H2 328 350 2.57e-3 SMART
ZnF_C2H2 356 378 2.43e-4 SMART
ZnF_C2H2 412 434 1.67e-2 SMART
ZnF_C2H2 440 462 1.28e-3 SMART
PHD 441 502 4.46e0 SMART
ZnF_C2H2 468 490 1.58e-3 SMART
ZnF_C2H2 496 518 2.95e-3 SMART
ZnF_C2H2 524 546 4.47e-3 SMART
PHD 525 586 5.77e0 SMART
ZnF_C2H2 552 574 5.42e-2 SMART
ZnF_C2H2 580 602 1.03e-2 SMART
ZnF_C2H2 608 630 5.5e-3 SMART
PHD 609 670 1.52e1 SMART
ZnF_C2H2 636 658 6.99e-5 SMART
ZnF_C2H2 664 686 3.34e-2 SMART
ZnF_C2H2 720 742 3.63e-3 SMART
PHD 721 782 2.67e0 SMART
ZnF_C2H2 748 770 5.42e-2 SMART
ZnF_C2H2 776 798 5.14e-3 SMART
ZnF_C2H2 804 826 4.17e-3 SMART
ZnF_C2H2 832 854 1.47e-3 SMART
PHD 833 894 4.93e0 SMART
ZnF_C2H2 860 882 3.83e-2 SMART
ZnF_C2H2 888 910 4.4e-2 SMART
ZnF_C2H2 916 938 7.78e-3 SMART
ZnF_C2H2 944 966 4.17e-3 SMART
ZnF_C2H2 972 994 1.38e-3 SMART
ZnF_C2H2 1000 1022 1.69e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138725
SMART Domains Protein: ENSMUSP00000115783
Gene: ENSMUSG00000058093

DomainStartEndE-ValueType
KRAB 15 75 1.63e-28 SMART
ZnF_C2H2 142 164 3.58e-2 SMART
ZnF_C2H2 170 192 3.21e-4 SMART
ZnF_C2H2 198 220 6.78e-3 SMART
ZnF_C2H2 226 248 3.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224814
Predicted Effect probably benign
Transcript: ENSMUST00000225627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Other mutations in Zfp729b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Zfp729b APN 13 67595230 missense probably benign 0.09
IGL02852:Zfp729b APN 13 67592823 missense probably damaging 0.99
PIT4449001:Zfp729b UTSW 13 67591423 missense probably benign 0.01
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0450:Zfp729b UTSW 13 67591134 missense probably benign
R0510:Zfp729b UTSW 13 67591134 missense probably benign
R1122:Zfp729b UTSW 13 67595284 missense possibly damaging 0.75
R1400:Zfp729b UTSW 13 67592794 missense possibly damaging 0.63
R1915:Zfp729b UTSW 13 67593220 missense probably damaging 1.00
R1929:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2229:Zfp729b UTSW 13 67595265 missense probably damaging 0.99
R2270:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2271:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2344:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2377:Zfp729b UTSW 13 67591701 missense possibly damaging 0.70
R2930:Zfp729b UTSW 13 67591854 missense probably benign
R3053:Zfp729b UTSW 13 67593466 missense probably damaging 1.00
R3404:Zfp729b UTSW 13 67591164 missense probably damaging 0.98
R4118:Zfp729b UTSW 13 67592710 missense possibly damaging 0.91
R4947:Zfp729b UTSW 13 67596672 missense probably damaging 1.00
R5408:Zfp729b UTSW 13 67591444 missense probably benign 0.18
R5511:Zfp729b UTSW 13 67592380 missense probably damaging 1.00
R5542:Zfp729b UTSW 13 67591021 missense probably benign
R5908:Zfp729b UTSW 13 67591255 missense probably benign 0.00
R5977:Zfp729b UTSW 13 67591621 missense probably benign 0.03
R5996:Zfp729b UTSW 13 67593858 missense probably benign 0.18
R7086:Zfp729b UTSW 13 67592937 missense probably damaging 0.99
R7146:Zfp729b UTSW 13 67593376 missense probably damaging 1.00
R7217:Zfp729b UTSW 13 67595248 missense probably damaging 0.96
R7332:Zfp729b UTSW 13 67609636 utr 5 prime probably null
R7472:Zfp729b UTSW 13 67593883 missense probably benign 0.00
R7615:Zfp729b UTSW 13 67591498 missense possibly damaging 0.77
R7639:Zfp729b UTSW 13 67591852 missense probably benign 0.02
R7738:Zfp729b UTSW 13 67592075 missense probably benign 0.00
X0023:Zfp729b UTSW 13 67592459 missense possibly damaging 0.95
X0028:Zfp729b UTSW 13 67592194 missense probably damaging 1.00
Z1088:Zfp729b UTSW 13 67593070 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGCCCGTCTACATACTTCAG -3'
(R):5'- TGTAGCAAGACCTTCCATTATCC -3'

Sequencing Primer
(F):5'- CTGGGAATTAAACTCAGGACCTCTG -3'
(R):5'- CAAGACCTTCCATTATCCATCATTAC -3'
Posted On2019-10-24