Incidental Mutation 'R7652:Ebf2'
ID590944
Institutional Source Beutler Lab
Gene Symbol Ebf2
Ensembl Gene ENSMUSG00000022053
Gene Nameearly B cell factor 2
SynonymsMmot1, D14Ggc1e, O/E-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location67233292-67430918 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 67390567 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022637] [ENSMUST00000176029] [ENSMUST00000176161]
Predicted Effect probably null
Transcript: ENSMUST00000022637
SMART Domains Protein: ENSMUSP00000022637
Gene: ENSMUSG00000022053

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176029
SMART Domains Protein: ENSMUSP00000135782
Gene: ENSMUSG00000022053

DomainStartEndE-ValueType
Pfam:COE1_DBD 16 246 2.3e-145 PFAM
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176161
SMART Domains Protein: ENSMUSP00000135500
Gene: ENSMUSG00000022053

DomainStartEndE-ValueType
IPT 252 336 9.09e-8 SMART
HLH 337 386 3.39e-1 SMART
internal_repeat_1 388 412 2.68e-6 PROSPERO
low complexity region 454 484 N/A INTRINSIC
low complexity region 512 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the COE (Collier/Olf/EBF) family of non-basic, helix-loop-helix transcription factors that have a well conserved DNA binding domain. The COE family proteins play an important role in variety of developmental processes. Studies in mouse suggest that this gene may be involved in the differentiation of osteoblasts. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants show decreased viability, impaired olfactory neuron projection, and impaired mating, more so in male mice. Mice homozygous for another knock-out allele exhibit narcolepsy-cataplexy syndrome and decreased orexinergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Ebf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ebf2 APN 14 67239478 missense probably damaging 1.00
IGL01808:Ebf2 APN 14 67414483 missense probably benign 0.01
IGL02087:Ebf2 APN 14 67428096 missense probably benign 0.03
IGL02094:Ebf2 APN 14 67235240 missense possibly damaging 0.80
IGL02270:Ebf2 APN 14 67238953 missense probably damaging 1.00
IGL03222:Ebf2 APN 14 67411992 splice site probably null
IGL03390:Ebf2 APN 14 67424109 missense probably benign 0.19
R0044:Ebf2 UTSW 14 67310968 intron probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0062:Ebf2 UTSW 14 67238540 splice site probably benign
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0069:Ebf2 UTSW 14 67410050 missense probably damaging 0.99
R0505:Ebf2 UTSW 14 67371736 nonsense probably null
R2103:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R2438:Ebf2 UTSW 14 67387942 missense probably damaging 1.00
R3789:Ebf2 UTSW 14 67239493 critical splice donor site probably null
R4153:Ebf2 UTSW 14 67235223 missense probably damaging 1.00
R4348:Ebf2 UTSW 14 67239422 missense probably damaging 0.99
R4793:Ebf2 UTSW 14 67410082 missense probably damaging 1.00
R4991:Ebf2 UTSW 14 67389657 missense possibly damaging 0.87
R5164:Ebf2 UTSW 14 67390521 missense possibly damaging 0.94
R5222:Ebf2 UTSW 14 67313594 intron probably benign
R5227:Ebf2 UTSW 14 67247069 missense probably damaging 0.99
R5459:Ebf2 UTSW 14 67235201 missense probably benign 0.34
R5622:Ebf2 UTSW 14 67390558 missense possibly damaging 0.91
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6035:Ebf2 UTSW 14 67238974 missense probably damaging 1.00
R6265:Ebf2 UTSW 14 67424060 missense probably benign 0.00
R6893:Ebf2 UTSW 14 67237559 missense probably benign 0.22
R7078:Ebf2 UTSW 14 67423958 missense probably benign
R7394:Ebf2 UTSW 14 67237526 missense probably damaging 0.99
R7449:Ebf2 UTSW 14 67410020 missense probably damaging 0.99
R7724:Ebf2 UTSW 14 67424040 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTGACCTCTTTCTTTGG -3'
(R):5'- CCGAAGTGAGTTGCCATAGC -3'

Sequencing Primer
(F):5'- ACCTCTTTCTTTGGTGGCTTGTCTAG -3'
(R):5'- GACCATGCAGAAGTTTCTCAGGTC -3'
Posted On2019-10-24