Incidental Mutation 'R7652:Vmn2r96'
ID590948
Institutional Source Beutler Lab
Gene Symbol Vmn2r96
Ensembl Gene ENSMUSG00000091679
Gene Namevomeronasal 2, receptor 96
SynonymsEG433070
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18573151-18616003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18573570 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 59 (S59A)
Ref Sequence ENSEMBL: ENSMUSP00000135095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177244] [ENSMUST00000231261] [ENSMUST00000231286]
Predicted Effect probably benign
Transcript: ENSMUST00000177244
AA Change: S59A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135095
Gene: ENSMUSG00000091679
AA Change: S59A

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 245 4.2e-19 PFAM
Pfam:NCD3G 317 370 6.9e-21 PFAM
Pfam:7tm_3 400 639 3.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231261
AA Change: S59A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231286
AA Change: S59A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hdac3 T A 18: 37,954,919 probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Vmn2r96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00563:Vmn2r96 APN 17 18583815 missense probably benign 0.00
IGL00769:Vmn2r96 APN 17 18583819 missense probably benign 0.00
IGL01314:Vmn2r96 APN 17 18582964 missense probably benign 0.00
IGL01983:Vmn2r96 APN 17 18597265 missense probably damaging 0.99
IGL02314:Vmn2r96 APN 17 18583959 missense probably benign 0.01
IGL02600:Vmn2r96 APN 17 18597567 missense probably benign
IGL02672:Vmn2r96 APN 17 18598114 missense probably benign 0.02
IGL02750:Vmn2r96 APN 17 18582589 missense probably benign 0.01
IGL03068:Vmn2r96 APN 17 18582875 missense probably benign 0.00
IGL03411:Vmn2r96 APN 17 18586372 missense possibly damaging 0.88
R0316:Vmn2r96 UTSW 17 18582565 missense probably damaging 1.00
R0502:Vmn2r96 UTSW 17 18584000 missense probably benign
R0580:Vmn2r96 UTSW 17 18582638 missense probably damaging 1.00
R0652:Vmn2r96 UTSW 17 18597568 missense probably benign 0.05
R0789:Vmn2r96 UTSW 17 18582476 missense possibly damaging 0.81
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1462:Vmn2r96 UTSW 17 18597398 missense possibly damaging 0.94
R1660:Vmn2r96 UTSW 17 18597726 missense probably benign 0.00
R1755:Vmn2r96 UTSW 17 18582653 missense possibly damaging 0.50
R1843:Vmn2r96 UTSW 17 18597921 missense probably benign 0.14
R1943:Vmn2r96 UTSW 17 18586402 missense probably benign 0.09
R1993:Vmn2r96 UTSW 17 18583876 missense probably damaging 1.00
R2018:Vmn2r96 UTSW 17 18584001 missense probably benign
R2405:Vmn2r96 UTSW 17 18597840 missense probably damaging 0.96
R3977:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R3979:Vmn2r96 UTSW 17 18597679 missense probably damaging 1.00
R4059:Vmn2r96 UTSW 17 18598077 missense probably benign 0.20
R4693:Vmn2r96 UTSW 17 18583008 missense probably benign 0.03
R4709:Vmn2r96 UTSW 17 18582826 missense probably benign 0.36
R4776:Vmn2r96 UTSW 17 18597508 missense probably damaging 1.00
R4882:Vmn2r96 UTSW 17 18597604 missense probably damaging 1.00
R4920:Vmn2r96 UTSW 17 18582656 missense probably benign 0.07
R5143:Vmn2r96 UTSW 17 18583858 missense possibly damaging 0.65
R5301:Vmn2r96 UTSW 17 18597688 missense probably damaging 0.98
R5507:Vmn2r96 UTSW 17 18597829 missense probably damaging 1.00
R6151:Vmn2r96 UTSW 17 18583959 missense probably benign 0.01
R6181:Vmn2r96 UTSW 17 18583864 missense probably benign
R6339:Vmn2r96 UTSW 17 18583862 missense possibly damaging 0.84
R6404:Vmn2r96 UTSW 17 18597531 missense probably damaging 1.00
R6452:Vmn2r96 UTSW 17 18583855 missense probably benign 0.07
R6749:Vmn2r96 UTSW 17 18598090 missense probably damaging 0.99
R6813:Vmn2r96 UTSW 17 18581854 missense probably benign 0.04
R6851:Vmn2r96 UTSW 17 18582538 missense possibly damaging 0.95
R6944:Vmn2r96 UTSW 17 18597629 missense probably benign 0.16
R6949:Vmn2r96 UTSW 17 18597838 missense probably damaging 1.00
R6962:Vmn2r96 UTSW 17 18598021 missense probably damaging 0.99
R6990:Vmn2r96 UTSW 17 18583820 missense probably benign
R7149:Vmn2r96 UTSW 17 18597727 missense possibly damaging 0.89
R7346:Vmn2r96 UTSW 17 18582767 missense probably benign 0.15
R7385:Vmn2r96 UTSW 17 18583040 missense probably damaging 1.00
R7442:Vmn2r96 UTSW 17 18573400 missense probably benign 0.02
R7509:Vmn2r96 UTSW 17 18582733 missense probably benign 0.02
R7659:Vmn2r96 UTSW 17 18573487 missense probably benign 0.00
R7753:Vmn2r96 UTSW 17 18586401 missense possibly damaging 0.46
R7855:Vmn2r96 UTSW 17 18597868 missense possibly damaging 0.59
R7938:Vmn2r96 UTSW 17 18597868 missense possibly damaging 0.59
Z1088:Vmn2r96 UTSW 17 18597366 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGACCCATGATCTAATAGGATGTTCTC -3'
(R):5'- ACCTTTCCCTCTGAGTGAGC -3'

Sequencing Primer
(F):5'- CTTGGATTTTTATCTTCAGACTCCTG -3'
(R):5'- CTAAGAGTGAATTGGCCAA -3'
Posted On2019-10-24