Incidental Mutation 'R7652:Hdac3'
ID590952
Institutional Source Beutler Lab
Gene Symbol Hdac3
Ensembl Gene ENSMUSG00000024454
Gene Namehistone deacetylase 3
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7652 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37935844-37954988 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 37954919 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043437] [ENSMUST00000043498] [ENSMUST00000070709] [ENSMUST00000091932] [ENSMUST00000163128] [ENSMUST00000163591] [ENSMUST00000168056] [ENSMUST00000169360] [ENSMUST00000169498] [ENSMUST00000176104] [ENSMUST00000176902] [ENSMUST00000177058]
Predicted Effect probably benign
Transcript: ENSMUST00000043437
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043498
SMART Domains Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 11 315 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070709
SMART Domains Protein: ENSMUSP00000070280
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091932
SMART Domains Protein: ENSMUSP00000089552
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 8.3e-23 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163128
SMART Domains Protein: ENSMUSP00000127234
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163591
SMART Domains Protein: ENSMUSP00000129299
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168056
SMART Domains Protein: ENSMUSP00000130051
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.9e-23 PFAM
low complexity region 104 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169360
SMART Domains Protein: ENSMUSP00000129880
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 4.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169498
SMART Domains Protein: ENSMUSP00000128949
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176104
SMART Domains Protein: ENSMUSP00000135556
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 60 3.3e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176902
SMART Domains Protein: ENSMUSP00000135176
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177058
SMART Domains Protein: ENSMUSP00000135615
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene results in embryonic death at or around the time of gastrulation. Structural and functional abnormalities are also reported in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,169,218 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Aph1b T C 9: 66,784,541 T195A probably benign Het
Apoe G T 7: 19,696,610 R236S possibly damaging Het
Arap3 G T 18: 37,978,452 T1137K probably damaging Het
Arhgap45 C T 10: 80,028,838 A908V probably benign Het
Atp13a1 T C 8: 69,805,559 C965R probably damaging Het
C7 A G 15: 5,012,105 Y440H probably damaging Het
Cacna2d2 T C 9: 107,524,198 probably null Het
Ddah2 C A 17: 35,061,050 R173S possibly damaging Het
Dnajc11 T C 4: 151,974,225 Y337H probably damaging Het
Dnajc25 A G 4: 59,020,483 K302R probably benign Het
Dnajc6 A T 4: 101,606,677 Q209L probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Ebf2 G T 14: 67,390,567 probably null Het
Epx A G 11: 87,875,334 probably null Het
Eqtn T C 4: 94,928,337 Y73C probably damaging Het
Fam107b A G 2: 3,772,847 N21S probably benign Het
Fasn G A 11: 120,816,328 S857F probably damaging Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Gas8 A G 8: 123,526,536 I208V probably benign Het
Gm11127 A T 17: 36,056,783 V221D probably damaging Het
Gm3269 T C 14: 4,839,095 I88T probably benign Het
Gm36079 A T 13: 120,026,993 S7T possibly damaging Het
Gm8005 C A 14: 42,436,962 L136F Het
Grid2ip C A 5: 143,382,638 P743Q probably damaging Het
Hbs1l C T 10: 21,364,760 T626I probably benign Het
Hnrnpab T C 11: 51,605,573 Y94C probably damaging Het
Homer2 T C 7: 81,649,666 D17G probably damaging Het
Ikbke C T 1: 131,271,832 R308Q probably damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Klhl3 G A 13: 58,113,332 probably benign Het
Klk9 A T 7: 43,796,090 T235S probably benign Het
Kmt2c T C 5: 25,315,719 T1798A probably benign Het
Kri1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTCCTC 9: 21,281,056 probably benign Het
Krtap4-6 T C 11: 99,665,614 I96V unknown Het
Lef1 A C 3: 131,200,354 R354S probably damaging Het
Lrp6 A T 6: 134,511,245 L296* probably null Het
Maml2 T C 9: 13,621,649 Y720H Het
Mmrn1 A G 6: 60,977,506 N924D probably benign Het
Myh7b A G 2: 155,632,236 K1624E probably damaging Het
Nos3 T A 5: 24,383,612 V1112D probably damaging Het
Olfr1136 A G 2: 87,693,360 I174T probably damaging Het
Olfr1216 C T 2: 89,013,549 V172I probably benign Het
Olfr1384 T C 11: 49,513,685 F16L probably damaging Het
Olfr1437 C A 19: 12,322,287 C180F probably damaging Het
Olfr814 A T 10: 129,874,477 N93K probably damaging Het
Phospho1 T C 11: 95,830,819 L105S probably damaging Het
Prss35 T A 9: 86,755,970 N264K probably benign Het
Ptpn13 A G 5: 103,529,712 D732G probably benign Het
Rab18 A T 18: 6,783,123 T64S possibly damaging Het
Rft1 A G 14: 30,677,816 Q319R probably benign Het
Rgs7 T A 1: 175,093,830 M220L probably benign Het
Rnf13 A G 3: 57,764,351 N28S probably benign Het
Setd3 A T 12: 108,112,289 I311N probably damaging Het
Setd5 G A 6: 113,121,764 R786H probably damaging Het
Slc26a6 T C 9: 108,855,944 probably null Het
Slc26a9 A T 1: 131,763,896 T626S probably benign Het
Stom A T 2: 35,316,029 N229K probably benign Het
Tlr1 A T 5: 64,926,787 L149* probably null Het
Trpc3 C A 3: 36,638,528 V772F probably benign Het
Ube3a A G 7: 59,243,354 probably benign Het
Ugt2b35 T A 5: 87,001,510 F207I probably damaging Het
Usp53 A T 3: 122,953,235 D360E possibly damaging Het
Vmn2r96 T G 17: 18,573,570 S59A probably benign Het
Wdr70 A G 15: 8,079,216 C149R probably benign Het
Wnt3 A G 11: 103,812,464 T258A possibly damaging Het
Zfp729b T C 13: 67,591,252 T965A probably benign Het
Other mutations in Hdac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Hdac3 APN 18 37954885 missense possibly damaging 0.95
IGL00570:Hdac3 APN 18 37944121 splice site probably benign
IGL01511:Hdac3 APN 18 37952595 missense probably benign 0.16
IGL01559:Hdac3 APN 18 37943672 splice site probably benign
IGL01688:Hdac3 APN 18 37954879 missense possibly damaging 0.53
IGL02529:Hdac3 APN 18 37944132 missense probably benign 0.20
IGL02559:Hdac3 APN 18 37954891 missense probably damaging 1.00
IGL02702:Hdac3 APN 18 37941094 missense probably benign 0.00
PIT4520001:Hdac3 UTSW 18 37941764 missense probably damaging 1.00
R0173:Hdac3 UTSW 18 37941753 missense probably damaging 0.97
R0325:Hdac3 UTSW 18 37940952 critical splice donor site probably null
R0445:Hdac3 UTSW 18 37943724 missense probably damaging 0.99
R1341:Hdac3 UTSW 18 37954713 missense probably damaging 1.00
R2068:Hdac3 UTSW 18 37943516 missense probably damaging 1.00
R2761:Hdac3 UTSW 18 37945726 missense probably benign 0.19
R3805:Hdac3 UTSW 18 37945692 critical splice donor site probably null
R4467:Hdac3 UTSW 18 37952513 missense probably benign 0.03
R5928:Hdac3 UTSW 18 37941341 intron probably benign
R5929:Hdac3 UTSW 18 37941341 intron probably benign
R6341:Hdac3 UTSW 18 37944164 missense probably damaging 0.99
R6679:Hdac3 UTSW 18 37944933 missense possibly damaging 0.59
R6843:Hdac3 UTSW 18 37941954 missense probably benign
R7262:Hdac3 UTSW 18 37945563 missense probably damaging 0.99
R7559:Hdac3 UTSW 18 37945516 missense possibly damaging 0.94
R7585:Hdac3 UTSW 18 37945355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGCGATGAGGTTTCATTG -3'
(R):5'- GTTCTGAGTCTCAAGCCTCG -3'

Sequencing Primer
(F):5'- CATTGGGTGTCCAGCTCCTGAG -3'
(R):5'- TGAGTCTCAAGCCTCGGAATCTG -3'
Posted On2019-10-24