Incidental Mutation 'R7285:Ythdf3'
ID590955
Institutional Source Beutler Lab
Gene Symbol Ythdf3
Ensembl Gene ENSMUSG00000047213
Gene NameYTH domain family 3
Synonyms9130022A11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location16183212-16217037 bp(+) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to A at 16203885 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108345] [ENSMUST00000108346] [ENSMUST00000191774]
Predicted Effect probably null
Transcript: ENSMUST00000108345
SMART Domains Protein: ENSMUSP00000103982
Gene: ENSMUSG00000047213

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
low complexity region 134 161 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
low complexity region 289 351 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Pfam:YTH 415 553 1.5e-50 PFAM
low complexity region 567 582 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108346
SMART Domains Protein: ENSMUSP00000103983
Gene: ENSMUSG00000047213

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
low complexity region 145 172 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 300 362 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Pfam:YTH 427 562 1.1e-44 PFAM
low complexity region 578 593 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191774
SMART Domains Protein: ENSMUSP00000141610
Gene: ENSMUSG00000047213

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 138 165 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 293 355 N/A INTRINSIC
low complexity region 383 398 N/A INTRINSIC
Pfam:YTH 419 557 1.6e-50 PFAM
low complexity region 571 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the YTH (YT521-B homology) domain protein family. The YTH domain is common in eukaryotes, is often found in the middle of the protein sequence, and may function in binding to RNA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Ythdf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02585:Ythdf3 APN 3 16189478 missense probably benign 0.01
IGL03068:Ythdf3 APN 3 16204718 missense possibly damaging 0.92
Disinclined UTSW 3 16203192 nonsense probably null
R0501:Ythdf3 UTSW 3 16205072 missense probably damaging 0.98
R0644:Ythdf3 UTSW 3 16204892 missense possibly damaging 0.46
R1667:Ythdf3 UTSW 3 16204892 missense possibly damaging 0.46
R1940:Ythdf3 UTSW 3 16205092 missense possibly damaging 0.71
R2121:Ythdf3 UTSW 3 16205192 missense possibly damaging 0.71
R2191:Ythdf3 UTSW 3 16203211 intron probably benign
R2341:Ythdf3 UTSW 3 16203215 intron probably benign
R2512:Ythdf3 UTSW 3 16204895 missense possibly damaging 0.66
R2850:Ythdf3 UTSW 3 16203818 splice site probably benign
R3037:Ythdf3 UTSW 3 16205191 missense probably benign 0.32
R4934:Ythdf3 UTSW 3 16204056 missense probably damaging 0.97
R5007:Ythdf3 UTSW 3 16205198 missense possibly damaging 0.51
R5164:Ythdf3 UTSW 3 16183513 missense possibly damaging 0.67
R5172:Ythdf3 UTSW 3 16204034 missense probably damaging 1.00
R5480:Ythdf3 UTSW 3 16183500 missense possibly damaging 0.83
R5512:Ythdf3 UTSW 3 16183922 missense probably damaging 0.98
R6059:Ythdf3 UTSW 3 16203192 nonsense probably null
R6104:Ythdf3 UTSW 3 16205161 missense possibly damaging 0.51
R6273:Ythdf3 UTSW 3 16204856 missense possibly damaging 0.92
R6721:Ythdf3 UTSW 3 16203861 missense possibly damaging 0.72
R7187:Ythdf3 UTSW 3 16204287 missense probably benign 0.05
R7307:Ythdf3 UTSW 3 16183500 missense possibly damaging 0.83
R7816:Ythdf3 UTSW 3 16189517 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATTTGAGTCCAGCTGGGCAG -3'
(R):5'- TGTAGAGAAATCAGCATTACCAGG -3'

Sequencing Primer
(F):5'- GACTTAACTATAGGGTGATGGTACTC -3'
(R):5'- AAAAAGTTAAATCCATGTTGACCAAG -3'
Posted On2019-10-25