Incidental Mutation 'R7285:Ece1'
ID 590956
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Name endothelin converting enzyme 1
Synonyms
MMRRC Submission 045393-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.800) question?
Stock # R7285 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 137589548-137692540 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 137641074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518] [ENSMUST00000130407] [ENSMUST00000151110]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000102518
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130407
Predicted Effect probably null
Transcript: ENSMUST00000151110
SMART Domains Protein: ENSMUSP00000114671
Gene: ENSMUSG00000057530

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Peptidase_M13_N 121 206 1.4e-29 PFAM
Meta Mutation Damage Score 0.9698 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,388,314 (GRCm39) C185* probably null Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Adam1b T G 5: 121,639,056 (GRCm39) D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 (GRCm39) L148Q probably damaging Het
Cdh4 A T 2: 179,439,258 (GRCm39) Q135L probably benign Het
Clca3b T C 3: 144,543,519 (GRCm39) I437V probably benign Het
Cldn15 A T 5: 137,001,327 (GRCm39) H124L probably benign Het
Cyp4a30b T C 4: 115,313,848 (GRCm39) M143T probably damaging Het
Dgcr2 A T 16: 17,662,944 (GRCm39) C353* probably null Het
Dhcr24 T A 4: 106,428,716 (GRCm39) probably null Het
Dock1 T G 7: 134,346,737 (GRCm39) L223R probably benign Het
Efcab5 A G 11: 77,028,170 (GRCm39) V387A probably benign Het
Efcab5 A G 11: 77,029,041 (GRCm39) F97L possibly damaging Het
Eme2 A T 17: 25,113,543 (GRCm39) probably null Het
Enpp1 G A 10: 24,536,059 (GRCm39) T447I probably benign Het
Fam222b T C 11: 78,034,007 (GRCm39) S17P probably benign Het
Fbln1 A G 15: 85,121,829 (GRCm39) I317V probably benign Het
Fn1 T C 1: 71,676,498 (GRCm39) K578E probably damaging Het
Fscb A T 12: 64,518,323 (GRCm39) S1048T unknown Het
Fsd1l T A 4: 53,682,200 (GRCm39) probably null Het
Hexa T A 9: 59,471,222 (GRCm39) I492K probably benign Het
Inpp5e G A 2: 26,287,870 (GRCm39) A642V probably benign Het
Ints11 C T 4: 155,970,568 (GRCm39) A241V probably damaging Het
Irs2 A G 8: 11,056,797 (GRCm39) L545P probably damaging Het
Katnal2 G A 18: 77,081,271 (GRCm39) A409V probably benign Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Lbx2 A G 6: 83,064,877 (GRCm39) K138R probably damaging Het
Lcor A G 19: 41,572,754 (GRCm39) K503R possibly damaging Het
Lpp G A 16: 24,796,029 (GRCm39) A558T probably damaging Het
Lypla1 T C 1: 4,911,321 (GRCm39) I202T probably benign Het
Magi3 G A 3: 103,941,430 (GRCm39) P842S probably benign Het
Meioc G A 11: 102,557,168 (GRCm39) V25M probably benign Het
Mthfr C T 4: 148,138,056 (GRCm39) T557I probably benign Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Or2t44 T A 11: 58,677,310 (GRCm39) Y83* probably null Het
Or5d20-ps1 A T 2: 87,932,049 (GRCm39) I94N probably damaging Het
Osbpl10 A T 9: 115,052,771 (GRCm39) I440F probably damaging Het
Otx2 G A 14: 48,898,922 (GRCm39) A36V probably benign Het
Parg A G 14: 31,932,465 (GRCm39) Y435C probably damaging Het
Parvb A T 15: 84,166,985 (GRCm39) D100V possibly damaging Het
Prss27 A G 17: 24,264,665 (GRCm39) H276R probably benign Het
Prune1 T A 3: 95,162,357 (GRCm39) S439C probably damaging Het
Pudp C G 18: 50,701,287 (GRCm39) E149Q possibly damaging Het
Qng1 T C 13: 58,532,199 (GRCm39) Y119C probably damaging Het
Sin3a C A 9: 57,034,583 (GRCm39) T1252N possibly damaging Het
Sptbn2 A G 19: 4,787,471 (GRCm39) D927G probably benign Het
Stx18 C T 5: 38,262,251 (GRCm39) T89I possibly damaging Het
Ticrr T C 7: 79,310,610 (GRCm39) S175P possibly damaging Het
Tinag T C 9: 76,952,943 (GRCm39) T14A probably benign Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Trpm1 G T 7: 63,859,729 (GRCm39) E396* probably null Het
Txndc11 A G 16: 10,902,163 (GRCm39) Y684H probably damaging Het
Usp47 G A 7: 111,692,315 (GRCm39) E926K probably benign Het
Vmn1r233 A G 17: 21,214,221 (GRCm39) I243T probably damaging Het
Ythdf3 T A 3: 16,258,049 (GRCm39) probably null Het
Zfp12 A G 5: 143,230,444 (GRCm39) K289R probably damaging Het
Zfp950 T A 19: 61,107,550 (GRCm39) H511L probably benign Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137,665,969 (GRCm39) missense probably damaging 1.00
IGL01538:Ece1 APN 4 137,675,855 (GRCm39) missense probably benign
IGL01588:Ece1 APN 4 137,684,517 (GRCm39) splice site probably benign
IGL01678:Ece1 APN 4 137,690,044 (GRCm39) missense probably damaging 1.00
IGL02619:Ece1 APN 4 137,666,044 (GRCm39) missense probably benign 0.08
IGL02936:Ece1 APN 4 137,673,612 (GRCm39) missense probably benign 0.01
IGL02956:Ece1 APN 4 137,690,149 (GRCm39) missense probably damaging 0.99
IGL03332:Ece1 APN 4 137,673,666 (GRCm39) missense probably damaging 0.99
R0063:Ece1 UTSW 4 137,675,892 (GRCm39) missense probably benign 0.14
R0240:Ece1 UTSW 4 137,676,746 (GRCm39) splice site probably benign
R1004:Ece1 UTSW 4 137,653,550 (GRCm39) missense probably benign 0.04
R1515:Ece1 UTSW 4 137,678,819 (GRCm39) missense probably benign 0.00
R1541:Ece1 UTSW 4 137,675,971 (GRCm39) splice site probably null
R1796:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1834:Ece1 UTSW 4 137,685,439 (GRCm39) missense probably damaging 0.99
R1834:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1836:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1930:Ece1 UTSW 4 137,666,074 (GRCm39) missense probably benign 0.01
R1931:Ece1 UTSW 4 137,666,074 (GRCm39) missense probably benign 0.01
R2065:Ece1 UTSW 4 137,685,393 (GRCm39) missense probably benign 0.04
R2281:Ece1 UTSW 4 137,673,673 (GRCm39) missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137,675,855 (GRCm39) missense probably benign
R4720:Ece1 UTSW 4 137,684,486 (GRCm39) missense probably damaging 1.00
R4773:Ece1 UTSW 4 137,672,464 (GRCm39) missense probably benign 0.00
R5794:Ece1 UTSW 4 137,683,844 (GRCm39) missense probably damaging 0.99
R5969:Ece1 UTSW 4 137,689,051 (GRCm39) critical splice donor site probably null
R6056:Ece1 UTSW 4 137,688,958 (GRCm39) missense probably damaging 1.00
R6332:Ece1 UTSW 4 137,685,319 (GRCm39) missense probably damaging 1.00
R6648:Ece1 UTSW 4 137,648,470 (GRCm39) missense probably benign 0.00
R7387:Ece1 UTSW 4 137,666,095 (GRCm39) missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137,641,133 (GRCm39) missense probably benign
R8294:Ece1 UTSW 4 137,675,931 (GRCm39) missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137,664,075 (GRCm39) missense probably damaging 0.99
R8806:Ece1 UTSW 4 137,672,452 (GRCm39) missense probably damaging 1.00
R9578:Ece1 UTSW 4 137,641,133 (GRCm39) missense probably benign
X0063:Ece1 UTSW 4 137,653,686 (GRCm39) missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137,648,338 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GGGACCTCATTGTAAAAGAAACCTC -3'
(R):5'- GGAAACCAGCCTCAGAGTAC -3'

Sequencing Primer
(F):5'- AACTCTCGCGGAAGGCCTG -3'
(R):5'- CAGAGCTGCTTGTGTGCAC -3'
Posted On 2019-10-25