Incidental Mutation 'R7359:Grsf1'
ID590964
Institutional Source Beutler Lab
Gene Symbol Grsf1
Ensembl Gene ENSMUSG00000044221
Gene NameG-rich RNA sequence binding factor 1
SynonymsD5Wsu31e
MMRRC Submission
Accession Numbers

Genbank: NM_178700; MGI: 106479

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7359 (G1)
Quality Score109.008
Status Validated
Chromosome5
Chromosomal Location88659448-88676171 bp(-) (GRCm38)
Type of Mutationintron (193 bp from exon)
DNA Base Change (assembly) A to T at 88665564 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078945] [ENSMUST00000113234] [ENSMUST00000153565]
Predicted Effect probably null
Transcript: ENSMUST00000078945
SMART Domains Protein: ENSMUSP00000077972
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 64 101 N/A INTRINSIC
low complexity region 124 139 N/A INTRINSIC
RRM 150 224 1.65e-6 SMART
RRM 250 321 1.79e-11 SMART
RRM 401 471 1.54e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113234
SMART Domains Protein: ENSMUSP00000108860
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
RRM 33 107 1.65e-6 SMART
RRM 133 204 1.79e-11 SMART
RRM 284 354 1.54e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153565
SMART Domains Protein: ENSMUSP00000123051
Gene: ENSMUSG00000044221

DomainStartEndE-ValueType
internal_repeat_1 2 33 5.45e-5 PROSPERO
RRM 52 123 1.79e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cellular protein that binds RNAs containing the G-rich element. The protein is localized in the cytoplasm, and has been shown to stimulate translation of viral mRNAs in vitro. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,189,574 V1233A possibly damaging Het
Abcc9 G A 6: 142,671,682 T552I probably damaging Het
Adgrf4 T C 17: 42,667,112 I447V possibly damaging Het
Akirin2 T A 4: 34,565,944 D178E probably damaging Het
Arhgap12 T C 18: 6,065,709 E359G possibly damaging Het
Arhgef5 A C 6: 43,280,282 T1256P probably damaging Het
Avpr1a A C 10: 122,449,378 I192L possibly damaging Het
B4galnt4 A G 7: 141,071,284 H926R probably damaging Het
BC067074 T C 13: 113,342,430 S1503P Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc68 C T 18: 69,956,052 A222V probably benign Het
Cdc23 T C 18: 34,641,341 Y295C probably benign Het
Ceacam10 T C 7: 24,781,007 Y188H unknown Het
Cfap57 T A 4: 118,598,965 T511S probably benign Het
Cftr T C 6: 18,221,624 V245A probably benign Het
Cit A G 5: 115,926,574 D505G probably damaging Het
Cmah T G 13: 24,468,556 N556K probably benign Het
D430041D05Rik C A 2: 104,214,137 D839Y probably damaging Het
Dek T C 13: 47,105,589 D47G unknown Het
Des C T 1: 75,360,952 R179C probably damaging Het
Desi2 A G 1: 178,187,943 N10D probably benign Het
Dlg5 T C 14: 24,164,547 N679S probably damaging Het
Dnajc24 T C 2: 106,001,948 Y30C probably damaging Het
Dock10 T A 1: 80,709,348 H34L probably benign Het
Dock5 A G 14: 67,765,888 V1586A probably benign Het
Dpy19l4 A G 4: 11,273,125 V576A probably benign Het
Dusp6 A G 10: 99,264,065 E125G probably benign Het
Dync1h1 T C 12: 110,624,602 Y1035H probably benign Het
Dysf G A 6: 84,195,324 probably null Het
En1 A G 1: 120,607,088 K369E unknown Het
F2r A G 13: 95,604,686 Y114H probably damaging Het
Fam184a T C 10: 53,699,222 Y97C probably damaging Het
Fggy T C 4: 95,769,480 V286A probably benign Het
Flot2 T C 11: 78,058,557 I322T probably benign Het
Fndc1 A T 17: 7,813,486 probably null Het
Frs3 A G 17: 47,699,525 D28G probably damaging Het
Gimap3 C T 6: 48,765,346 D217N probably benign Het
Gm128 A G 3: 95,240,623 V120A probably benign Het
Gm14548 T A 7: 3,898,104 probably benign Het
Gm17190 T C 13: 96,082,462 V102A probably damaging Het
Gm17268 A G 11: 82,028,231 V20A unknown Het
Hmcn2 A T 2: 31,388,383 Y1699F probably benign Het
Hnmt T A 2: 24,048,719 M36L probably benign Het
Hoxd1 C A 2: 74,764,103 T234K probably damaging Het
Hydin C G 8: 110,506,101 S1679R probably damaging Het
Jag1 T C 2: 137,084,306 R1059G probably benign Het
Kbtbd11 T C 8: 15,028,858 W486R probably damaging Het
Kcnh6 A G 11: 106,018,963 D438G possibly damaging Het
Lgals4 T G 7: 28,841,299 F276V probably benign Het
Lrp6 G T 6: 134,450,960 Y1556* probably null Het
Mpdz G A 4: 81,356,395 L855F probably benign Het
Muc16 A T 9: 18,643,020 D3992E unknown Het
Npc1 T C 18: 12,195,180 N1024S probably benign Het
Nsfl1c A G 2: 151,494,359 T18A probably benign Het
Olfr1120 T A 2: 87,358,211 L256I possibly damaging Het
Olfr130 G A 17: 38,067,615 W148* probably null Het
Olfr358 A T 2: 37,005,437 M59K probably damaging Het
Olfr949-ps1 T C 9: 39,365,479 *307R probably null Het
Pcdh15 A T 10: 74,584,216 K1235N probably damaging Het
Pcif1 A G 2: 164,884,331 K51E probably damaging Het
Pde1b G A 15: 103,521,325 D82N probably damaging Het
Phf23 T A 11: 69,998,641 V167E possibly damaging Het
Pik3c2g T C 6: 139,967,894 V1006A unknown Het
Pkhd1l1 G T 15: 44,589,486 V3936F probably damaging Het
Pnpla1 T C 17: 28,881,185 V342A probably benign Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppl A G 16: 5,089,341 L1030P possibly damaging Het
Prelid1 A T 13: 55,321,275 probably benign Het
Racgap1 C T 15: 99,631,200 S264N probably benign Het
Rdh13 T C 7: 4,427,697 D289G probably benign Het
Rtp3 T C 9: 110,986,296 I334V probably benign Het
Setd2 A T 9: 110,562,944 D200V Het
Simc1 A G 13: 54,503,918 S15G unknown Het
Sirpb1c A T 3: 15,833,225 M150K probably benign Het
Smoc1 T A 12: 81,150,701 D202E probably damaging Het
Spata31d1b A G 13: 59,712,490 Y59C probably damaging Het
Stard9 A G 2: 120,698,280 T1673A probably damaging Het
Tbc1d31 T A 15: 57,916,108 H72Q probably benign Het
Tgfbrap1 C A 1: 43,075,533 V136L probably damaging Het
Top2b A G 14: 16,407,376 N720S probably null Het
Vmn1r11 T C 6: 57,138,199 S283P probably damaging Het
Vmn1r19 A G 6: 57,405,095 H211R probably damaging Het
Vmn2r44 A T 7: 8,367,539 M836K probably benign Het
Vmn2r61 A C 7: 42,265,983 H118P probably benign Het
Vps33a A G 5: 123,558,633 I319T probably benign Het
Vwf T A 6: 125,566,257 S151T Het
Zfp423 T C 8: 87,782,243 N491S possibly damaging Het
Zfp626 T C 7: 27,808,235 F23S probably damaging Het
Other mutations in Grsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Grsf1 APN 5 88670278 missense probably damaging 1.00
IGL01505:Grsf1 APN 5 88672749 nonsense probably null
IGL02108:Grsf1 APN 5 88665903 missense probably benign 0.35
IGL02116:Grsf1 APN 5 88670174 critical splice donor site probably null
IGL02713:Grsf1 APN 5 88672730 missense probably damaging 1.00
IGL02881:Grsf1 APN 5 88673830 missense probably damaging 1.00
R0336:Grsf1 UTSW 5 88663153 missense probably damaging 0.96
R1381:Grsf1 UTSW 5 88665864 missense probably benign 0.10
R1398:Grsf1 UTSW 5 88665847 missense probably benign 0.03
R2136:Grsf1 UTSW 5 88672658 missense probably benign 0.05
R2398:Grsf1 UTSW 5 88673836 missense probably damaging 1.00
R4181:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4182:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4183:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R4184:Grsf1 UTSW 5 88664156 missense probably benign 0.00
R5315:Grsf1 UTSW 5 88673775 start gained probably benign
R6246:Grsf1 UTSW 5 88662592 missense possibly damaging 0.81
R7381:Grsf1 UTSW 5 88665807 missense probably benign 0.02
R7430:Grsf1 UTSW 5 88663227 missense possibly damaging 0.67
R7703:Grsf1 UTSW 5 88671291 missense probably damaging 1.00
R7838:Grsf1 UTSW 5 88675664 start gained probably benign
R7921:Grsf1 UTSW 5 88675664 start gained probably benign
R8013:Grsf1 UTSW 5 88675756 critical splice donor site probably null
YA93:Grsf1 UTSW 5 88673735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACTACTCTATTCAGCATGAGC -3'
(R):5'- ATTGCCTTGTACCTTTCGGG -3'

Sequencing Primer
(F):5'- ACTGCTCTTCTGAAGGTCCAGAG -3'
(R):5'- GTTTGTTAAGACTTTTCATGGCTAGC -3'
Posted On2019-10-25