Mutagenetix > Incidental Mutation

Incidental Mutation 'R7345:Speg'

590992

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

045379-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75384835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 70 (L70P)

Ref Sequence

ENSEMBL: ENSMUSP00000119969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113590] [ENSMUST00000125306] [ENSMUST00000148515]

AlphaFold

no structure available at present

Predicted Effect

silent
Transcript: ENSMUST00000087122

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000113590

SMART Domains

Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	186	212	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	253	262	N/A	INTRINSIC
low complexity region	306	317	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
IGc2	633	700	2.19e-9	SMART
low complexity region	752	764	N/A	INTRINSIC
IGc2	780	848	4.03e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125306
AA Change: L70P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

silent
Transcript: ENSMUST00000132228

Predicted Effect

probably benign
Transcript: ENSMUST00000137868

Predicted Effect

silent
Transcript: ENSMUST00000148515

SMART Domains

Protein: ENSMUSP00000116953
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	113	126	N/A	INTRINSIC
low complexity region	137	163	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	204	213	N/A	INTRINSIC
low complexity region	257	268	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks3	A	G	16: 4,955,910	M174T	possibly damaging	Het
Arhgap23	G	A	11: 97,466,478	R934Q	possibly damaging	Het
Atad5	T	C	11: 80,096,006	S640P	probably damaging	Het
B3galnt2	C	T	13: 13,980,480		probably null	Het
B430305J03Rik	T	C	3: 61,364,118	S69G	unknown	Het
C87499	T	C	4: 88,628,179	K309E	possibly damaging	Het
Cd163	A	T	6: 124,318,938	N747I	possibly damaging	Het
Cep126	A	G	9: 8,099,816	S906P	probably damaging	Het
Cyp4f39	G	A	17: 32,486,779	G318R	probably damaging	Het
D630003M21Rik	C	T	2: 158,217,209	G257D	probably damaging	Het
Dcaf10	T	C	4: 45,342,583	L139P	probably damaging	Het
Dcc	A	G	18: 71,378,824	V840A	probably benign	Het
Dnhd1	A	T	7: 105,703,967	I2776L	probably benign	Het
Fam166b	T	C	4: 43,428,022	D145G	possibly damaging	Het
Fbxo24	G	T	5: 137,621,261	F234L	probably damaging	Het
Gm21190	T	C	5: 15,527,904		probably null	Het
Grhl3	C	T	4: 135,546,246	R565Q	probably damaging	Het
Gtf3c1	A	T	7: 125,645,670	Y1731N	probably damaging	Het
Il1a	C	A	2: 129,304,773	R133S	probably benign	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Klc3	G	A	7: 19,394,889	T481M	probably benign	Het
Map2k6	A	T	11: 110,492,908	I127F		Het
Mapk8	A	T	14: 33,408,111	N63K	probably damaging	Het
Med13l	T	C	5: 118,742,760	W1306R	probably damaging	Het
Megf6	C	A	4: 154,267,315	Q1162K	probably benign	Het
Myo5b	A	G	18: 74,708,024	E992G	possibly damaging	Het
Ndst4	C	T	3: 125,714,659	T291M	probably benign	Het
Nek10	T	A	14: 14,955,503	F838L	probably benign	Het
Nrm	A	G	17: 35,864,584	H194R	probably damaging	Het
Nup188	T	C	2: 30,340,601	S1384P	probably benign	Het
Olfml2a	C	A	2: 38,960,127	D618E	probably damaging	Het
Olfr466	A	C	13: 65,152,743	N173T	possibly damaging	Het
Olfr506	C	T	7: 108,613,063	T252I	probably benign	Het
Olfr937	A	G	9: 39,060,579	L29P	probably damaging	Het
Olfr938	G	A	9: 39,078,334	S137F	probably damaging	Het
P2ry1	T	C	3: 61,003,674	F78S	possibly damaging	Het
Pcdhb18	T	C	18: 37,491,923	F769L	probably benign	Het
Poc5	A	G	13: 96,396,796	E144G	probably damaging	Het
Pole	T	A	5: 110,303,903	N870K	possibly damaging	Het
Polr2b	T	C	5: 77,349,119	F1159L	possibly damaging	Het
Rubcnl	A	G	14: 75,042,353	Y392C	probably benign	Het
Sec31a	T	C	5: 100,385,270	T539A	probably damaging	Het
Serpinh1	A	C	7: 99,346,356	S340A	probably damaging	Het
Slc1a5	T	A	7: 16,796,160		probably null	Het
Soat2	A	G	15: 102,162,578	D469G	probably benign	Het
Spred2	T	C	11: 19,924,958		probably null	Het
Stac2	A	C	11: 98,042,613	S168A	probably damaging	Het
Stx1a	T	A	5: 135,037,188	D31E	probably benign	Het
Timeless	C	T	10: 128,249,754	T885M	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tsen34	T	C	7: 3,695,615	Y253H	probably damaging	Het
Unc13b	T	C	4: 43,173,966	V1598A	unknown	Het
Zfat	A	T	15: 68,105,043	Y1086N	probably damaging	Het
Zfp551	G	A	7: 12,416,595	H296Y	probably benign	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75388873	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75422606	missense	probably benign	0.30
R9019:Speg	UTSW	1	75429238	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75388432	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75385010	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75422734	missense	probably benign	0.01
R9117:Speg	UTSW	1	75387800	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75390993	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75384854	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75421776	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75417733	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75422508	missense	probably benign
R9475:Speg	UTSW	1	75388091	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75415736	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75387803	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75422782	missense	probably benign	0.08
R9553:Speg	UTSW	1	75418001	missense	probably benign	0.00
R9767:Speg	UTSW	1	75427181	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75418973	nonsense	probably null
R9800:Speg	UTSW	1	75422714	missense	probably benign	0.03
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGACTGCCGAGGATGACATC -3'
(R):5'- ACCAGATTAGCTCGCGATGC -3'

Sequencing Primer
(F):5'- CCGAGGATGACATCAGCGATG -3'
(R):5'- CACCAGCGGCTCCACCC -3'

Posted On

2019-11-01