Incidental Mutation 'R7061:Pkn3'
ID 590997
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Name protein kinase N3
Synonyms
MMRRC Submission 045384-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7061 (G1)
Quality Score 62.01
Status Validated
Chromosome 2
Chromosomal Location 29967696-29981034 bp(+) (GRCm39)
Type of Mutation splice site (154 bp from exon)
DNA Base Change (assembly) T to A at 29973548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000125346] [ENSMUST00000150770]
AlphaFold Q8K045
Predicted Effect probably null
Transcript: ENSMUST00000045246
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125346
SMART Domains Protein: ENSMUSP00000120268
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 19 82 3.45e-17 SMART
Hr1 102 170 6.19e-19 SMART
Hr1 175 238 6.4e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150770
SMART Domains Protein: ENSMUSP00000114492
Gene: ENSMUSG00000026785

DomainStartEndE-ValueType
Hr1 28 91 3.45e-17 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aard G A 15: 51,903,617 (GRCm39) M13I probably benign Het
Abcb5 A C 12: 118,841,509 (GRCm39) Y979D probably damaging Het
Adgrb1 G C 15: 74,441,730 (GRCm39) V4L probably benign Het
Ap3b2 C T 7: 81,110,757 (GRCm39) R1006Q unknown Het
Bpifa6 A T 2: 153,834,236 (GRCm39) T343S probably benign Het
Celsr3 T A 9: 108,724,793 (GRCm39) C2957* probably null Het
Chd6 G A 2: 160,867,885 (GRCm39) Q428* probably null Het
Col5a1 C A 2: 27,915,690 (GRCm39) C191* probably null Het
Cpox A G 16: 58,491,223 (GRCm39) I145V possibly damaging Het
Csnk2a1 C T 2: 152,116,091 (GRCm39) R268C probably benign Het
Dclk2 A G 3: 86,739,038 (GRCm39) probably null Het
Dennd5a T C 7: 109,504,386 (GRCm39) E909G probably benign Het
Depdc1a T A 3: 159,228,489 (GRCm39) S414T possibly damaging Het
Dock5 A G 14: 68,007,703 (GRCm39) F1502S probably damaging Het
Dop1b G T 16: 93,558,951 (GRCm39) A448S probably benign Het
Dsg1c C A 18: 20,410,066 (GRCm39) N511K probably benign Het
Epc2 G T 2: 49,425,334 (GRCm39) R108L probably damaging Het
Erp44 T A 4: 48,219,375 (GRCm39) I147F probably benign Het
Evc T C 5: 37,476,446 (GRCm39) T368A possibly damaging Het
Fbxo41 G T 6: 85,452,448 (GRCm39) R738S probably benign Het
Fli1 T C 9: 32,335,518 (GRCm39) T305A probably damaging Het
Grk5 A G 19: 61,034,530 (GRCm39) T93A probably benign Het
Grm2 A T 9: 106,528,424 (GRCm39) N153K probably damaging Het
Helz A G 11: 107,540,003 (GRCm39) T1007A possibly damaging Het
Helz2 A G 2: 180,882,307 (GRCm39) L162P probably damaging Het
Hmgcr T A 13: 96,802,656 (GRCm39) Q81L possibly damaging Het
Hnrnpu T C 1: 178,163,691 (GRCm39) K218E unknown Het
Hydin A T 8: 111,329,920 (GRCm39) I4885F possibly damaging Het
Ibsp A G 5: 104,457,768 (GRCm39) probably null Het
Igfals T C 17: 25,099,281 (GRCm39) L124P probably damaging Het
Il24 T A 1: 130,811,108 (GRCm39) H142L possibly damaging Het
Iqca1l A G 5: 24,750,063 (GRCm39) M660T probably benign Het
Kcnh2 A T 5: 24,536,920 (GRCm39) H221Q probably benign Het
Man1a A G 10: 53,796,331 (GRCm39) S454P probably damaging Het
Meiosin A T 7: 18,834,053 (GRCm39) probably benign Het
Mfsd4b1 C T 10: 39,879,382 (GRCm39) V172M possibly damaging Het
Mical2 T A 7: 111,946,008 (GRCm39) I763K probably benign Het
Mybpc3 A G 2: 90,955,749 (GRCm39) I594M possibly damaging Het
Neo1 T A 9: 58,897,724 (GRCm39) R77S possibly damaging Het
Nlrp6 A G 7: 140,502,780 (GRCm39) I265M probably benign Het
Or52n5 T C 7: 104,587,883 (GRCm39) L50P probably damaging Het
Or5bw2 A G 7: 6,573,782 (GRCm39) Y264C probably damaging Het
Or8b9 T A 9: 37,766,942 (GRCm39) V276D possibly damaging Het
Pcdhgb5 C A 18: 37,864,976 (GRCm39) P257Q probably benign Het
Phactr1 A G 13: 43,286,457 (GRCm39) D586G probably damaging Het
Prob1 A T 18: 35,787,553 (GRCm39) S234T probably benign Het
Rab14 A T 2: 35,073,429 (GRCm39) L131* probably null Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rhebl1 A G 15: 98,777,164 (GRCm39) L103P probably damaging Het
Rnf10 G T 5: 115,395,149 (GRCm39) F146L probably damaging Het
Rrbp1 T C 2: 143,831,087 (GRCm39) K360R possibly damaging Het
Slc6a9 C T 4: 117,725,261 (GRCm39) T575I probably benign Het
Smo A G 6: 29,760,229 (GRCm39) H776R probably damaging Het
Speer1f T C 5: 11,469,071 (GRCm39) V74A possibly damaging Het
Tns2 A G 15: 102,012,914 (GRCm39) M1V probably null Het
Ttn C A 2: 76,725,036 (GRCm39) probably benign Het
Ugt3a1 A T 15: 9,306,240 (GRCm39) M130L probably benign Het
Urb2 C T 8: 124,755,036 (GRCm39) H248Y probably benign Het
Vit A T 17: 78,932,585 (GRCm39) N564I probably damaging Het
Vmn1r60 A T 7: 5,547,310 (GRCm39) Y263* probably null Het
Vmn2r16 A T 5: 109,511,620 (GRCm39) Y609F probably damaging Het
Xpo7 T C 14: 70,908,512 (GRCm39) I876V probably benign Het
Zfp442 A G 2: 150,249,937 (GRCm39) I655T probably benign Het
Zfp574 T A 7: 24,779,622 (GRCm39) C215S possibly damaging Het
Zfp608 T C 18: 55,121,069 (GRCm39) T173A probably benign Het
Zfp69 A T 4: 120,788,598 (GRCm39) V239D possibly damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 29,971,116 (GRCm39) missense probably damaging 0.97
IGL00781:Pkn3 APN 2 29,973,402 (GRCm39) unclassified probably benign
IGL00815:Pkn3 APN 2 29,971,212 (GRCm39) missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 29,977,054 (GRCm39) missense probably damaging 1.00
IGL01897:Pkn3 APN 2 29,972,824 (GRCm39) unclassified probably benign
IGL02513:Pkn3 APN 2 29,973,149 (GRCm39) missense probably damaging 0.98
IGL02552:Pkn3 APN 2 29,970,879 (GRCm39) missense probably damaging 1.00
IGL02622:Pkn3 APN 2 29,973,158 (GRCm39) missense probably benign 0.28
IGL02689:Pkn3 APN 2 29,970,858 (GRCm39) missense probably damaging 1.00
IGL02996:Pkn3 APN 2 29,970,627 (GRCm39) missense probably benign 0.39
IGL03106:Pkn3 APN 2 29,975,257 (GRCm39) missense probably damaging 0.96
Enflamme UTSW 2 29,973,049 (GRCm39) unclassified probably benign
Wrath UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 29,980,539 (GRCm39) missense probably damaging 1.00
R0279:Pkn3 UTSW 2 29,973,309 (GRCm39) missense probably benign 0.16
R0370:Pkn3 UTSW 2 29,977,184 (GRCm39) missense probably damaging 1.00
R0491:Pkn3 UTSW 2 29,979,889 (GRCm39) missense probably damaging 1.00
R0600:Pkn3 UTSW 2 29,971,146 (GRCm39) missense probably benign 0.06
R1418:Pkn3 UTSW 2 29,973,059 (GRCm39) missense probably damaging 1.00
R1510:Pkn3 UTSW 2 29,969,776 (GRCm39) critical splice donor site probably null
R1535:Pkn3 UTSW 2 29,977,065 (GRCm39) missense probably benign
R1540:Pkn3 UTSW 2 29,974,703 (GRCm39) missense probably damaging 1.00
R1808:Pkn3 UTSW 2 29,969,663 (GRCm39) missense probably damaging 1.00
R1884:Pkn3 UTSW 2 29,972,840 (GRCm39) missense probably damaging 1.00
R1995:Pkn3 UTSW 2 29,979,989 (GRCm39) missense probably damaging 1.00
R3745:Pkn3 UTSW 2 29,980,353 (GRCm39) missense probably damaging 1.00
R4119:Pkn3 UTSW 2 29,973,049 (GRCm39) unclassified probably benign
R4258:Pkn3 UTSW 2 29,978,572 (GRCm39) missense probably damaging 0.99
R4665:Pkn3 UTSW 2 29,975,469 (GRCm39) unclassified probably benign
R4772:Pkn3 UTSW 2 29,974,692 (GRCm39) splice site probably null
R4808:Pkn3 UTSW 2 29,980,093 (GRCm39) missense probably damaging 1.00
R5038:Pkn3 UTSW 2 29,975,293 (GRCm39) critical splice donor site probably null
R5388:Pkn3 UTSW 2 29,971,086 (GRCm39) missense probably damaging 0.99
R5488:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R5611:Pkn3 UTSW 2 29,969,673 (GRCm39) missense probably damaging 1.00
R6001:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R6277:Pkn3 UTSW 2 29,972,957 (GRCm39) missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 29,970,699 (GRCm39) critical splice donor site probably null
R6724:Pkn3 UTSW 2 29,980,562 (GRCm39) missense possibly damaging 0.94
R7128:Pkn3 UTSW 2 29,973,327 (GRCm39) missense probably damaging 1.00
R7249:Pkn3 UTSW 2 29,974,773 (GRCm39) missense probably benign 0.00
R7475:Pkn3 UTSW 2 29,977,122 (GRCm39) missense probably benign 0.01
R7746:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7747:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7783:Pkn3 UTSW 2 29,969,634 (GRCm39) missense probably damaging 1.00
R8401:Pkn3 UTSW 2 29,970,071 (GRCm39) missense probably benign 0.00
R8425:Pkn3 UTSW 2 29,976,513 (GRCm39) critical splice donor site probably null
R8535:Pkn3 UTSW 2 29,969,936 (GRCm39) critical splice acceptor site probably null
R8720:Pkn3 UTSW 2 29,975,196 (GRCm39) missense probably benign 0.01
R8743:Pkn3 UTSW 2 29,973,318 (GRCm39) missense probably benign 0.00
R9415:Pkn3 UTSW 2 29,968,332 (GRCm39) missense probably benign 0.20
R9437:Pkn3 UTSW 2 29,973,267 (GRCm39) missense possibly damaging 0.93
R9583:Pkn3 UTSW 2 29,976,723 (GRCm39) missense probably null 0.99
R9800:Pkn3 UTSW 2 29,973,290 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGACTTCCTGGACAATGCC -3'
(R):5'- TAGGCCTGTCTGTGAACCTG -3'

Sequencing Primer
(F):5'- TCTCAGTCTGGTGCCTCAGG -3'
(R):5'- CCAGTTTTTATCACACAGATGCAC -3'
Posted On 2019-11-01