Mutagenetix > Incidental Mutations

Incidental Mutation 'R7061:Ibsp'

590998

Institutional Source

Beutler Lab

Gene Symbol

Ibsp

Ensembl Gene

ENSMUSG00000029306

Gene Name

integrin binding sialoprotein

Synonyms

Bsp2, bone sialoprotein, BSP

MMRRC Submission

Accession Numbers

Genbank: NM_008318.3

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R7061 (G1)

Quality Score

150.008

Status

Validated

Chromosome

Chromosomal Location

104299171-104311469 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 104309902 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031246]

Predicted Effect

probably null
Transcript: ENSMUST00000031246

SMART Domains

Protein: ENSMUSP00000031246
Gene: ENSMUSG00000029306

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:BSP_II	17	321	2.8e-127	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major structural protein of the bone matrix. It constitutes approximately 12% of the noncollagenous proteins in human bone and is synthesized by skeletal-associated cell types, including hypertrophic chondrocytes, osteoblasts, osteocytes, and osteoclasts. The only extraskeletal site of its synthesis is the trophoblast. This protein binds to calcium and hydroxyapatite via its acidic amino acid clusters, and mediates cell attachment through an RGD sequence that recognizes the vitronectin receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight/size, delayed long bone growth and mineralization with low bone turn over due to reduced osteoclast formation, delayed intramembranous ossification, progressive periodontal breakdown, and severe alveolar and mandibular bone loss. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,545,065	M660T	probably benign	Het
Aard	G	A	15: 52,040,221	M13I	probably benign	Het
Abcb5	A	C	12: 118,877,774	Y979D	probably damaging	Het
Adgrb1	G	C	15: 74,569,881	V4L	probably benign	Het
Ap3b2	C	T	7: 81,461,009	R1006Q	unknown	Het
Bpifa6	A	T	2: 153,992,316	T343S	probably benign	Het
Celsr3	T	A	9: 108,847,594	C2957*	probably null	Het
Chd6	G	A	2: 161,025,965	Q428*	probably null	Het
Col5a1	C	A	2: 28,025,678	C191*	probably null	Het
Cpox	A	G	16: 58,670,860	I145V	possibly damaging	Het
Csnk2a1	C	T	2: 152,274,171	R268C	probably benign	Het
Dclk2	A	G	3: 86,831,731		probably null	Het
Dennd5a	T	C	7: 109,905,179	E909G	probably benign	Het
Depdc1a	T	A	3: 159,522,852	S414T	possibly damaging	Het
Dock5	A	G	14: 67,770,254	F1502S	probably damaging	Het
Dopey2	G	T	16: 93,762,063	A448S	probably benign	Het
Dsg1c	C	A	18: 20,277,009	N511K	probably benign	Het
Epc2	G	T	2: 49,535,322	R108L	probably damaging	Het
Erp44	T	A	4: 48,219,375	I147F	probably benign	Het
Evc	T	C	5: 37,319,102	T368A	possibly damaging	Het
Fbxo41	G	T	6: 85,475,466	R738S	probably benign	Het
Fli1	T	C	9: 32,424,222	T305A	probably damaging	Het
Gm4969	A	T	7: 19,100,128		probably benign	Het
Gm8897	T	C	5: 11,419,104	V74A	possibly damaging	Het
Grk5	A	G	19: 61,046,092	T93A	probably benign	Het
Grm2	A	T	9: 106,651,225	N153K	probably damaging	Het
Helz	A	G	11: 107,649,177	T1007A	possibly damaging	Het
Helz2	A	G	2: 181,240,514	L162P	probably damaging	Het
Hmgcr	T	A	13: 96,666,148	Q81L	possibly damaging	Het
Hnrnpu	T	C	1: 178,336,126	K218E	unknown	Het
Hydin	A	T	8: 110,603,288	I4885F	possibly damaging	Het
Igfals	T	C	17: 24,880,307	L124P	probably damaging	Het
Il24	T	A	1: 130,883,371	H142L	possibly damaging	Het
Kcnh2	A	T	5: 24,331,922	H221Q	probably benign	Het
Man1a	A	G	10: 53,920,235	S454P	probably damaging	Het
Mfsd4b1	C	T	10: 40,003,386	V172M	possibly damaging	Het
Mical2	T	A	7: 112,346,801	I763K	probably benign	Het
Mybpc3	A	G	2: 91,125,404	I594M	possibly damaging	Het
Neo1	T	A	9: 58,990,441	R77S	possibly damaging	Het
Nlrp6	A	G	7: 140,922,867	I265M	probably benign	Het
Olfr1350	A	G	7: 6,570,783	Y264C	probably damaging	Het
Olfr669	T	C	7: 104,938,676	L50P	probably damaging	Het
Olfr877	T	A	9: 37,855,646	V276D	possibly damaging	Het
Pcdhgb5	C	A	18: 37,731,923	P257Q	probably benign	Het
Phactr1	A	G	13: 43,132,981	D586G	probably damaging	Het
Pkn3	T	A	2: 30,083,536		probably null	Het
Prob1	A	T	18: 35,654,500	S234T	probably benign	Het
Rab14	A	T	2: 35,183,417	L131*	probably null	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rhebl1	A	G	15: 98,879,283	L103P	probably damaging	Het
Rnf10	G	T	5: 115,257,090	F146L	probably damaging	Het
Rrbp1	T	C	2: 143,989,167	K360R	possibly damaging	Het
Slc6a9	C	T	4: 117,868,064	T575I	probably benign	Het
Smo	A	G	6: 29,760,230	H776R	probably damaging	Het
Tns2	A	G	15: 102,104,479	M1V	probably null	Het
Ttn	C	A	2: 76,894,692		probably benign	Het
Ugt3a1	A	T	15: 9,306,154	M130L	probably benign	Het
Urb2	C	T	8: 124,028,297	H248Y	probably benign	Het
Vit	A	T	17: 78,625,156	N564I	probably damaging	Het
Vmn1r60	A	T	7: 5,544,311	Y263*	probably null	Het
Vmn2r16	A	T	5: 109,363,754	Y609F	probably damaging	Het
Xpo7	T	C	14: 70,671,072	I876V	probably benign	Het
Zfp442	A	G	2: 150,408,017	I655T	probably benign	Het
Zfp574	T	A	7: 25,080,197	C215S	possibly damaging	Het
Zfp608	T	C	18: 54,987,997	T173A	probably benign	Het
Zfp69	A	T	4: 120,931,401	V239D	possibly damaging	Het

Other mutations in Ibsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00687:Ibsp	APN	5	104310068	missense	probably benign	0.27
IGL02317:Ibsp	APN	5	104302466	missense	probably damaging	1.00
IGL02539:Ibsp	APN	5	104302283	missense	probably damaging	0.99
IGL03236:Ibsp	APN	5	104306005	missense	probably benign	0.30
crunch	UTSW	5	104309282	missense	probably damaging	1.00
I2289:Ibsp	UTSW	5	104302487	missense	possibly damaging	0.64
PIT4445001:Ibsp	UTSW	5	104302304	missense	possibly damaging	0.94
R0049:Ibsp	UTSW	5	104302158	missense	probably damaging	1.00
R0049:Ibsp	UTSW	5	104302158	missense	probably damaging	1.00
R0234:Ibsp	UTSW	5	104310069	small deletion	probably benign
R0610:Ibsp	UTSW	5	104310134	missense	probably benign	0.07
R0656:Ibsp	UTSW	5	104310020	critical splice acceptor site	probably null
R1168:Ibsp	UTSW	5	104302152	missense	probably damaging	0.99
R1440:Ibsp	UTSW	5	104310539	missense	unknown
R1569:Ibsp	UTSW	5	104310151	missense	probably damaging	1.00
R1921:Ibsp	UTSW	5	104310212	missense	probably damaging	1.00
R2172:Ibsp	UTSW	5	104310430	missense	probably damaging	1.00
R2879:Ibsp	UTSW	5	104310394	missense	possibly damaging	0.88
R4399:Ibsp	UTSW	5	104309282	missense	probably damaging	1.00
R4517:Ibsp	UTSW	5	104305997	nonsense	probably null
R5417:Ibsp	UTSW	5	104310469	missense	possibly damaging	0.95
R5575:Ibsp	UTSW	5	104310059	missense	possibly damaging	0.78
R6183:Ibsp	UTSW	5	104306030	missense	possibly damaging	0.95
R6273:Ibsp	UTSW	5	104310301	missense	probably benign	0.15
R6295:Ibsp	UTSW	5	104302121	splice site	probably null
R7133:Ibsp	UTSW	5	104302306	nonsense	probably null
R7202:Ibsp	UTSW	5	104302161	missense	probably benign	0.02
R7205:Ibsp	UTSW	5	104310431	missense	probably damaging	0.99
R7769:Ibsp	UTSW	5	104306005	missense	probably benign	0.15
R7769:Ibsp	UTSW	5	104310184	missense	probably damaging	0.97
R8506:Ibsp	UTSW	5	104310081	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGCTGTTGACAATTTGCG -3'
(R):5'- TCTGCACCTGCTTCAGTGAC -3'

Sequencing Primer
(F):5'- TTTGCGTAATAACAGAAGACAGC -3'
(R):5'- ACCTGCTTCAGTGACGCTTG -3'

Posted On

2019-11-01