Mutagenetix > Incidental Mutation

Incidental Mutation 'R7347:Col9a1'

591001

Institutional Source

Beutler Lab

Gene Symbol

Col9a1

Ensembl Gene

ENSMUSG00000026147

Gene Name

collagen, type IX, alpha 1

Synonyms

Col9a-1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R7347 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24177610-24252684 bp(+) (GRCm38)

Type of Mutation

splice site (42 bp from exon)

DNA Base Change (assembly)

A to G at 24179403 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000051579 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054588]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000054588

SMART Domains

Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
TSPN	50	244	5.73e-78	SMART
Pfam:Collagen	266	326	2e-11	PFAM
Pfam:Collagen	308	358	3.5e-9	PFAM
Pfam:Collagen	357	409	1.2e-8	PFAM
Pfam:Collagen	415	472	7.8e-11	PFAM
Pfam:Collagen	454	515	2.9e-11	PFAM
Pfam:Collagen	592	667	3.9e-8	PFAM
Pfam:Collagen	646	716	1.7e-9	PFAM
Pfam:Collagen	697	760	1.6e-10	PFAM
Pfam:Collagen	785	848	3.1e-11	PFAM
low complexity region	878	899	N/A	INTRINSIC

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	A	9: 103,282,646	E22V	possibly damaging	Het
4930564D02Rik	G	T	3: 105,078,412	R47S	unknown	Het
4931408C20Rik	A	T	1: 26,684,467	L544Q	probably benign	Het
Abtb2	T	G	2: 103,567,412	I229S	probably damaging	Het
Adgre1	T	C	17: 57,420,441	L457P	probably damaging	Het
Amer3	C	A	1: 34,587,902	D407E	probably damaging	Het
Arhgap20	T	C	9: 51,849,035	S729P	probably benign	Het
Asap2	T	G	12: 21,229,457	I418S	probably benign	Het
Atp5j2	T	C	5: 145,188,485		probably null	Het
Brinp3	T	A	1: 146,902,086	V757E	probably benign	Het
Brip1	C	T	11: 86,139,103	G572R	probably benign	Het
C3	C	A	17: 57,223,215	R462L	probably benign	Het
Cat	T	A	2: 103,463,298	H395L	probably benign	Het
Cela3a	T	C	4: 137,402,606	N235D	possibly damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cntnap1	G	T	11: 101,185,268	G993W	probably damaging	Het
Coro2b	G	T	9: 62,489,372	H29N	probably benign	Het
Dll3	C	T	7: 28,299,111	R143H	probably damaging	Het
Dsel	C	T	1: 111,861,573	G411S	probably damaging	Het
Dync1i1	T	A	6: 5,784,530	*114R	probably null	Het
Ecm2	T	C	13: 49,515,078	S86P	probably damaging	Het
Eif5	T	C	12: 111,540,290		probably benign	Het
Ets1	T	A	9: 32,733,032		probably null	Het
Exph5	A	G	9: 53,375,896	N1426D	possibly damaging	Het
Eya2	T	C	2: 165,687,666	F110L	probably benign	Het
Flt1	T	A	5: 147,580,381	E1032V	probably damaging	Het
Galnt5	A	T	2: 58,017,193	H556L	probably benign	Het
Glb1l3	A	T	9: 26,829,003	Y344N	probably benign	Het
Glrx3	C	A	7: 137,459,286	D216E	possibly damaging	Het
Gm45871	T	A	18: 90,591,375	C246S	probably damaging	Het
Gm8251	G	T	1: 44,059,496	P814Q	probably damaging	Het
Gm906	T	C	13: 50,245,744	I849V	probably benign	Het
Gstm4	A	G	3: 108,042,373	L137P	probably benign	Het
Hsd17b13	T	C	5: 103,968,750	T169A	probably damaging	Het
Hydin	A	C	8: 110,600,362	T4778P	probably benign	Het
Ifna15	A	G	4: 88,557,983	L88P	probably damaging	Het
Kcnab1	G	A	3: 65,376,531	R390H	probably benign	Het
Kng1	C	A	16: 23,067,787	H161N	possibly damaging	Het
Lamp5	T	C	2: 136,060,958	V199A	probably benign	Het
Lrig3	G	A	10: 126,009,966	V755M	probably damaging	Het
Mad1l1	C	T	5: 140,144,044	R412H	probably damaging	Het
March6	C	A	15: 31,486,359	C350F	probably benign	Het
Mastl	A	G	2: 23,133,389	S441P	probably damaging	Het
Mfsd13b	A	T	7: 120,991,728	M231L	probably benign	Het
Micalcl	T	C	7: 112,382,151	V444A	probably benign	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Myo15	A	G	11: 60,477,961	M516V	probably benign	Het
Myo1b	A	T	1: 51,751,254	F1110L	probably damaging	Het
Nbr1	T	A	11: 101,569,321	L381*	probably null	Het
Nln	T	C	13: 104,050,847	K325E	probably damaging	Het
Nr4a3	T	G	4: 48,051,290	S15A	possibly damaging	Het
Nrp2	C	T	1: 62,745,504	P271S	probably benign	Het
Obox6	A	C	7: 15,834,646	L102V	possibly damaging	Het
Olfr1008	T	C	2: 85,689,837	M136T	probably damaging	Het
Olfr1208	T	C	2: 88,897,271	I109V	possibly damaging	Het
Olfr1241	T	C	2: 89,482,455	S227G	probably benign	Het
Olfr853	A	G	9: 19,537,099	M277T	probably damaging	Het
Pde10a	A	G	17: 8,967,462	H567R	probably damaging	Het
Pdgfra	C	T	5: 75,183,098	S760L	possibly damaging	Het
Pid1	T	A	1: 84,159,129	I94L	unknown	Het
Plekhn1	T	C	4: 156,222,671	H474R	probably benign	Het
Prcc	A	T	3: 87,869,681	S329T	possibly damaging	Het
Pros1	G	T	16: 62,919,523	R445L	probably damaging	Het
Pxdn	C	A	12: 30,012,261	H1370Q	probably benign	Het
Sgce	T	A	6: 4,694,106	R283S	probably damaging	Het
Slc25a20	T	G	9: 108,682,458		probably null	Het
Slc6a1	T	C	6: 114,311,818	V446A	probably damaging	Het
Slc6a4	C	G	11: 77,017,085	Y358*	probably null	Het
Sned1	A	C	1: 93,281,736	E857A	probably damaging	Het
Spdye4b	C	T	5: 143,202,390	R213C	possibly damaging	Het
Spry2	T	G	14: 105,893,512	E80A	probably damaging	Het
Stard9	G	A	2: 120,666,534	C142Y	probably benign	Het
Sync	A	T	4: 129,294,306	Q377L	probably benign	Het
Tdrd12	A	G	7: 35,485,692	C718R		Het
Tgoln1	G	C	6: 72,616,278	T73R	probably benign	Het
Tmbim1	T	C	1: 74,291,279	E185G	probably benign	Het
Tyk2	T	C	9: 21,108,034	M1031V	probably damaging	Het
Vmn1r71	C	T	7: 10,748,501	V87I	not run	Het
Vmn2r49	A	G	7: 9,986,814	V250A	probably benign	Het
Yipf3	A	C	17: 46,250,827	T187P	probably damaging	Het
Zfp148	G	T	16: 33,434,790	R50L	possibly damaging	Het
Zfp628	G	A	7: 4,921,818	G1013E	probably damaging	Het

Other mutations in Col9a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Col9a1	APN	1	24185225	missense	unknown
IGL00517:Col9a1	APN	1	24195534	intron	probably benign
IGL01125:Col9a1	APN	1	24224645	critical splice acceptor site	probably null
IGL01505:Col9a1	APN	1	24185124	missense	unknown
IGL01583:Col9a1	APN	1	24185144	missense	unknown
IGL01627:Col9a1	APN	1	24179608	critical splice donor site	probably null
IGL01773:Col9a1	APN	1	24205066	missense	probably benign	0.17
IGL02117:Col9a1	APN	1	24237493	nonsense	probably null
IGL02192:Col9a1	APN	1	24221987	missense	probably damaging	1.00
IGL02346:Col9a1	APN	1	24223609	missense	probably damaging	0.96
IGL02383:Col9a1	APN	1	24185258	missense	unknown
IGL02453:Col9a1	APN	1	24179357	missense	unknown
IGL02553:Col9a1	APN	1	24221937	splice site	probably benign
IGL03412:Col9a1	APN	1	24210427	critical splice donor site	probably null
IGL03493:Col9a1	APN	1	24221570	splice site	probably benign
ANU74:Col9a1	UTSW	1	24185328	missense	unknown
R0076:Col9a1	UTSW	1	24237497	critical splice donor site	probably null
R0076:Col9a1	UTSW	1	24237497	critical splice donor site	probably null
R0090:Col9a1	UTSW	1	24223562	splice site	probably null
R0356:Col9a1	UTSW	1	24185247	nonsense	probably null
R0562:Col9a1	UTSW	1	24179279	splice site	probably null
R0584:Col9a1	UTSW	1	24224490	splice site	probably benign
R0708:Col9a1	UTSW	1	24237261	missense	possibly damaging	0.92
R1342:Col9a1	UTSW	1	24223620	critical splice donor site	probably null
R1445:Col9a1	UTSW	1	24237498	critical splice donor site	probably null
R1791:Col9a1	UTSW	1	24185305	missense	unknown
R1938:Col9a1	UTSW	1	24222473	missense	probably damaging	1.00
R2214:Col9a1	UTSW	1	24208202	missense	probably damaging	1.00
R2240:Col9a1	UTSW	1	24179501	missense	unknown
R3757:Col9a1	UTSW	1	24232231	critical splice donor site	probably null
R3891:Col9a1	UTSW	1	24185436	critical splice donor site	probably null
R4249:Col9a1	UTSW	1	24244381	missense	probably damaging	1.00
R4690:Col9a1	UTSW	1	24224706	splice site	probably null
R4918:Col9a1	UTSW	1	24237258	missense	possibly damaging	0.74
R4988:Col9a1	UTSW	1	24185192	missense	unknown
R5144:Col9a1	UTSW	1	24239353	missense	probably benign	0.08
R5327:Col9a1	UTSW	1	24195539	critical splice donor site	probably null
R5511:Col9a1	UTSW	1	24179538	missense	unknown
R5519:Col9a1	UTSW	1	24230254	splice site	probably null
R5564:Col9a1	UTSW	1	24195355	start gained	probably benign
R6076:Col9a1	UTSW	1	24195376	start gained	probably benign
R6478:Col9a1	UTSW	1	24185405	missense	unknown
R6886:Col9a1	UTSW	1	24185345	missense	unknown
R7177:Col9a1	UTSW	1	24195417	missense	unknown
R7259:Col9a1	UTSW	1	24185343	missense	unknown
R7268:Col9a1	UTSW	1	24207398	missense	possibly damaging	0.89
R7644:Col9a1	UTSW	1	24185162	missense	unknown
R7860:Col9a1	UTSW	1	24237180	missense	probably damaging	1.00
R8267:Col9a1	UTSW	1	24185186	missense	unknown
R8296:Col9a1	UTSW	1	24178299	missense	unknown
R8737:Col9a1	UTSW	1	24185046	missense	unknown
R8773:Col9a1	UTSW	1	24185127	missense	unknown
R8795:Col9a1	UTSW	1	24194731	missense	unknown
R8878:Col9a1	UTSW	1	24196967	critical splice donor site	probably null
R8956:Col9a1	UTSW	1	24237219	missense	probably damaging	1.00
R8978:Col9a1	UTSW	1	24239315	missense	probably damaging	1.00
R9096:Col9a1	UTSW	1	24185126	missense	unknown
R9097:Col9a1	UTSW	1	24185126	missense	unknown
R9205:Col9a1	UTSW	1	24185094	missense	unknown
R9534:Col9a1	UTSW	1	24185169	missense	unknown
Z1176:Col9a1	UTSW	1	24214588	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTCCTCTTGTAGTGGATGC -3'
(R):5'- CGCACTTAAGGAAGGTAATTAGAGTC -3'

Sequencing Primer
(F):5'- ATGCATTGGATGAGACAGTATTGC -3'
(R):5'- ACCTTGTTGGAATCCTGAAGTC -3'

Posted On

2019-11-04