Incidental Mutation 'R7347:Cep89'
ID591003
Institutional Source Beutler Lab
Gene Symbol Cep89
Ensembl Gene ENSMUSG00000023072
Gene Namecentrosomal protein 89
SynonymsCcdc123, 2610507L03Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028120; MGI: 1919390

Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R7347 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35397035-35438689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35429928 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 630 (R630H)
Ref Sequence ENSEMBL: ENSMUSP00000121393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079414] [ENSMUST00000141704] [ENSMUST00000206230]
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141704
AA Change: R630H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072
AA Change: R630H

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150421
SMART Domains Protein: ENSMUSP00000121422
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
coiled coil region 77 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206230
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,282,646 E22V possibly damaging Het
4930564D02Rik G T 3: 105,078,412 R47S unknown Het
4931408C20Rik A T 1: 26,684,467 L544Q probably benign Het
Abtb2 T G 2: 103,567,412 I229S probably damaging Het
Adgre1 T C 17: 57,420,441 L457P probably damaging Het
Amer3 C A 1: 34,587,902 D407E probably damaging Het
Arhgap20 T C 9: 51,849,035 S729P probably benign Het
Asap2 T G 12: 21,229,457 I418S probably benign Het
Atp5j2 T C 5: 145,188,485 probably null Het
Brinp3 T A 1: 146,902,086 V757E probably benign Het
Brip1 C T 11: 86,139,103 G572R probably benign Het
C3 C A 17: 57,223,215 R462L probably benign Het
Cat T A 2: 103,463,298 H395L probably benign Het
Cela3a T C 4: 137,402,606 N235D possibly damaging Het
Cntnap1 G T 11: 101,185,268 G993W probably damaging Het
Col9a1 A G 1: 24,179,403 probably null Het
Coro2b G T 9: 62,489,372 H29N probably benign Het
Dll3 C T 7: 28,299,111 R143H probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 *114R probably null Het
Ecm2 T C 13: 49,515,078 S86P probably damaging Het
Eif5 T C 12: 111,540,290 probably benign Het
Ets1 T A 9: 32,733,032 probably null Het
Exph5 A G 9: 53,375,896 N1426D possibly damaging Het
Eya2 T C 2: 165,687,666 F110L probably benign Het
Flt1 T A 5: 147,580,381 E1032V probably damaging Het
Galnt5 A T 2: 58,017,193 H556L probably benign Het
Glb1l3 A T 9: 26,829,003 Y344N probably benign Het
Glrx3 C A 7: 137,459,286 D216E possibly damaging Het
Gm45871 T A 18: 90,591,375 C246S probably damaging Het
Gm8251 G T 1: 44,059,496 P814Q probably damaging Het
Gm906 T C 13: 50,245,744 I849V probably benign Het
Gstm4 A G 3: 108,042,373 L137P probably benign Het
Hsd17b13 T C 5: 103,968,750 T169A probably damaging Het
Hydin A C 8: 110,600,362 T4778P probably benign Het
Ifna15 A G 4: 88,557,983 L88P probably damaging Het
Kcnab1 G A 3: 65,376,531 R390H probably benign Het
Kng1 C A 16: 23,067,787 H161N possibly damaging Het
Lamp5 T C 2: 136,060,958 V199A probably benign Het
Lrig3 G A 10: 126,009,966 V755M probably damaging Het
Mad1l1 C T 5: 140,144,044 R412H probably damaging Het
March6 C A 15: 31,486,359 C350F probably benign Het
Mastl A G 2: 23,133,389 S441P probably damaging Het
Mfsd13b A T 7: 120,991,728 M231L probably benign Het
Micalcl T C 7: 112,382,151 V444A probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 A G 11: 60,477,961 M516V probably benign Het
Myo1b A T 1: 51,751,254 F1110L probably damaging Het
Nbr1 T A 11: 101,569,321 L381* probably null Het
Nln T C 13: 104,050,847 K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Nrp2 C T 1: 62,745,504 P271S probably benign Het
Obox6 A C 7: 15,834,646 L102V possibly damaging Het
Olfr1008 T C 2: 85,689,837 M136T probably damaging Het
Olfr1208 T C 2: 88,897,271 I109V possibly damaging Het
Olfr1241 T C 2: 89,482,455 S227G probably benign Het
Olfr853 A G 9: 19,537,099 M277T probably damaging Het
Pde10a A G 17: 8,967,462 H567R probably damaging Het
Pdgfra C T 5: 75,183,098 S760L possibly damaging Het
Pid1 T A 1: 84,159,129 I94L unknown Het
Plekhn1 T C 4: 156,222,671 H474R probably benign Het
Prcc A T 3: 87,869,681 S329T possibly damaging Het
Pros1 G T 16: 62,919,523 R445L probably damaging Het
Pxdn C A 12: 30,012,261 H1370Q probably benign Het
Sgce T A 6: 4,694,106 R283S probably damaging Het
Slc25a20 T G 9: 108,682,458 probably null Het
Slc6a1 T C 6: 114,311,818 V446A probably damaging Het
Slc6a4 C G 11: 77,017,085 Y358* probably null Het
Sned1 A C 1: 93,281,736 E857A probably damaging Het
Spdye4b C T 5: 143,202,390 R213C possibly damaging Het
Spry2 T G 14: 105,893,512 E80A probably damaging Het
Stard9 G A 2: 120,666,534 C142Y probably benign Het
Sync A T 4: 129,294,306 Q377L probably benign Het
Tdrd12 A G 7: 35,485,692 C718R Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmbim1 T C 1: 74,291,279 E185G probably benign Het
Tyk2 T C 9: 21,108,034 M1031V probably damaging Het
Vmn1r71 C T 7: 10,748,501 V87I not run Het
Vmn2r49 A G 7: 9,986,814 V250A probably benign Het
Yipf3 A C 17: 46,250,827 T187P probably damaging Het
Zfp148 G T 16: 33,434,790 R50L possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Cep89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Cep89 APN 7 35405707 missense possibly damaging 0.92
IGL01546:Cep89 APN 7 35420900 missense probably damaging 1.00
IGL02001:Cep89 APN 7 35403007 splice site probably benign
IGL02141:Cep89 APN 7 35420924 missense probably damaging 1.00
IGL02468:Cep89 APN 7 35403152 missense probably benign 0.35
IGL02507:Cep89 APN 7 35435565 missense probably damaging 1.00
IGL02612:Cep89 APN 7 35424655 critical splice acceptor site probably null
IGL03324:Cep89 APN 7 35424653 intron probably benign
IGL03396:Cep89 APN 7 35429178 missense probably benign 0.05
3-1:Cep89 UTSW 7 35424722 missense probably damaging 0.99
FR4304:Cep89 UTSW 7 35409641 utr 3 prime probably benign
FR4976:Cep89 UTSW 7 35409641 utr 3 prime probably benign
K2124:Cep89 UTSW 7 35420972 splice site probably benign
R0127:Cep89 UTSW 7 35428262 missense possibly damaging 0.92
R0416:Cep89 UTSW 7 35416402 unclassified probably benign
R0609:Cep89 UTSW 7 35435530 missense probably damaging 1.00
R1442:Cep89 UTSW 7 35418211 splice site probably benign
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1661:Cep89 UTSW 7 35417680 missense possibly damaging 0.66
R3981:Cep89 UTSW 7 35438383 missense probably damaging 1.00
R4414:Cep89 UTSW 7 35416397 unclassified probably benign
R4700:Cep89 UTSW 7 35438437 missense probably benign 0.05
R4963:Cep89 UTSW 7 35403152 missense probably benign 0.35
R4968:Cep89 UTSW 7 35409630 missense possibly damaging 0.90
R4972:Cep89 UTSW 7 35432552 missense probably damaging 1.00
R5578:Cep89 UTSW 7 35409642 unclassified probably benign
R5767:Cep89 UTSW 7 35417645 missense probably damaging 1.00
R5809:Cep89 UTSW 7 35417726 missense probably damaging 0.97
R5890:Cep89 UTSW 7 35429162 missense probably damaging 0.99
R6290:Cep89 UTSW 7 35420263 missense probably damaging 1.00
R6361:Cep89 UTSW 7 35398047 missense probably damaging 1.00
R6627:Cep89 UTSW 7 35427747 missense possibly damaging 0.90
R7272:Cep89 UTSW 7 35438463 missense probably benign 0.03
R7340:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7348:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7365:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7366:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7399:Cep89 UTSW 7 35438378 missense probably damaging 1.00
R7422:Cep89 UTSW 7 35428247 missense probably damaging 1.00
R7819:Cep89 UTSW 7 35432543 missense probably benign 0.07
V7732:Cep89 UTSW 7 35403098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGACAATCACAGGCCATG -3'
(R):5'- GAAGGCTTGTAAGAAACATCACC -3'

Sequencing Primer
(F):5'- AATCACAGGCCATGCTGGG -3'
(R):5'- CTTGTAAGAAACATCACCTGGAAGTC -3'
Posted On2019-11-04