Incidental Mutation 'R7347:Ets1'
ID 591004
Institutional Source Beutler Lab
Gene Symbol Ets1
Ensembl Gene ENSMUSG00000032035
Gene Name E26 avian leukemia oncogene 1, 5' domain
Synonyms Ets-1, Tpl1, p51Ets-1, vs, p42Ets-1
MMRRC Submission 045374-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.894) question?
Stock # R7347 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 32547517-32669116 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to A at 32644328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034534] [ENSMUST00000050797] [ENSMUST00000184364] [ENSMUST00000184887]
AlphaFold P27577
Predicted Effect probably null
Transcript: ENSMUST00000034534
SMART Domains Protein: ENSMUSP00000034534
Gene: ENSMUSG00000032035

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
low complexity region 266 278 N/A INTRINSIC
ETS 334 419 1.98e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000050797
SMART Domains Protein: ENSMUSP00000051303
Gene: ENSMUSG00000032035

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
ETS 247 332 1.98e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184364
SMART Domains Protein: ENSMUSP00000139107
Gene: ENSMUSG00000032035

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
ETS 118 203 1.98e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184887
SMART Domains Protein: ENSMUSP00000138951
Gene: ENSMUSG00000032035

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral CD8+ T cells, impaired TCR-mediated activation of both CD4+ and CD8+ T cells, increased numbers of IgM-secreting plasma cells, and severely impaired NK cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930564D02Rik G T 3: 104,985,728 (GRCm39) R47S unknown Het
Abtb2 T G 2: 103,397,757 (GRCm39) I229S probably damaging Het
Adgre1 T C 17: 57,727,441 (GRCm39) L457P probably damaging Het
Amer3 C A 1: 34,626,983 (GRCm39) D407E probably damaging Het
Arhgap20 T C 9: 51,760,335 (GRCm39) S729P probably benign Het
Asap2 T G 12: 21,279,458 (GRCm39) I418S probably benign Het
Atp5mf T C 5: 145,125,295 (GRCm39) probably null Het
Brinp3 T A 1: 146,777,824 (GRCm39) V757E probably benign Het
Brip1 C T 11: 86,029,929 (GRCm39) G572R probably benign Het
C3 C A 17: 57,530,215 (GRCm39) R462L probably benign Het
Cat T A 2: 103,293,643 (GRCm39) H395L probably benign Het
Ccdc168 G T 1: 44,098,656 (GRCm39) P814Q probably damaging Het
Cela3a T C 4: 137,129,917 (GRCm39) N235D possibly damaging Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cntnap1 G T 11: 101,076,094 (GRCm39) G993W probably damaging Het
Col9a1 A G 1: 24,218,484 (GRCm39) probably null Het
Coro2b G T 9: 62,396,654 (GRCm39) H29N probably benign Het
Dll3 C T 7: 27,998,536 (GRCm39) R143H probably damaging Het
Dsel C T 1: 111,789,303 (GRCm39) G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 (GRCm39) *114R probably null Het
Ecm2 T C 13: 49,668,554 (GRCm39) S86P probably damaging Het
Eif5 T C 12: 111,506,724 (GRCm39) probably benign Het
Exph5 A G 9: 53,287,196 (GRCm39) N1426D possibly damaging Het
Eya2 T C 2: 165,529,586 (GRCm39) F110L probably benign Het
Flt1 T A 5: 147,517,191 (GRCm39) E1032V probably damaging Het
Galnt5 A T 2: 57,907,205 (GRCm39) H556L probably benign Het
Glb1l3 A T 9: 26,740,299 (GRCm39) Y344N probably benign Het
Glrx3 C A 7: 137,061,015 (GRCm39) D216E possibly damaging Het
Gm45871 T A 18: 90,609,499 (GRCm39) C246S probably damaging Het
Gstm4 A G 3: 107,949,689 (GRCm39) L137P probably benign Het
Hsd17b13 T C 5: 104,116,616 (GRCm39) T169A probably damaging Het
Hydin A C 8: 111,326,994 (GRCm39) T4778P probably benign Het
Ifna15 A G 4: 88,476,220 (GRCm39) L88P probably damaging Het
Inhca T A 9: 103,159,845 (GRCm39) E22V possibly damaging Het
Kcnab1 G A 3: 65,283,952 (GRCm39) R390H probably benign Het
Kng1 C A 16: 22,886,537 (GRCm39) H161N possibly damaging Het
Lamp5 T C 2: 135,902,878 (GRCm39) V199A probably benign Het
Lrig3 G A 10: 125,845,835 (GRCm39) V755M probably damaging Het
Mad1l1 C T 5: 140,129,799 (GRCm39) R412H probably damaging Het
Marchf6 C A 15: 31,486,505 (GRCm39) C350F probably benign Het
Mastl A G 2: 23,023,401 (GRCm39) S441P probably damaging Het
Mfsd13b A T 7: 120,590,951 (GRCm39) M231L probably benign Het
Mical2 T C 7: 111,981,358 (GRCm39) V444A probably benign Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Myo15a A G 11: 60,368,787 (GRCm39) M516V probably benign Het
Myo1b A T 1: 51,790,413 (GRCm39) F1110L probably damaging Het
Nbr1 T A 11: 101,460,147 (GRCm39) L381* probably null Het
Nln T C 13: 104,187,355 (GRCm39) K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 (GRCm39) S15A possibly damaging Het
Nrp2 C T 1: 62,784,663 (GRCm39) P271S probably benign Het
Obox6 A C 7: 15,568,571 (GRCm39) L102V possibly damaging Het
Or4a69 T C 2: 89,312,799 (GRCm39) S227G probably benign Het
Or4p8 T C 2: 88,727,615 (GRCm39) I109V possibly damaging Het
Or7g33 A G 9: 19,448,395 (GRCm39) M277T probably damaging Het
Or8k16 T C 2: 85,520,181 (GRCm39) M136T probably damaging Het
Pde10a A G 17: 9,186,294 (GRCm39) H567R probably damaging Het
Pdgfra C T 5: 75,343,759 (GRCm39) S760L possibly damaging Het
Pid1 T A 1: 84,136,850 (GRCm39) I94L unknown Het
Plekhn1 T C 4: 156,307,128 (GRCm39) H474R probably benign Het
Prcc A T 3: 87,776,988 (GRCm39) S329T possibly damaging Het
Pros1 G T 16: 62,739,886 (GRCm39) R445L probably damaging Het
Pxdn C A 12: 30,062,260 (GRCm39) H1370Q probably benign Het
Sgce T A 6: 4,694,106 (GRCm39) R283S probably damaging Het
Slc25a20 T G 9: 108,559,657 (GRCm39) probably null Het
Slc6a1 T C 6: 114,288,779 (GRCm39) V446A probably damaging Het
Slc6a4 C G 11: 76,907,911 (GRCm39) Y358* probably null Het
Sned1 A C 1: 93,209,458 (GRCm39) E857A probably damaging Het
Spata31e2 A T 1: 26,723,548 (GRCm39) L544Q probably benign Het
Spata31e3 T C 13: 50,399,780 (GRCm39) I849V probably benign Het
Spdye4b C T 5: 143,188,145 (GRCm39) R213C possibly damaging Het
Spry2 T G 14: 106,130,946 (GRCm39) E80A probably damaging Het
Stard9 G A 2: 120,497,015 (GRCm39) C142Y probably benign Het
Sync A T 4: 129,188,099 (GRCm39) Q377L probably benign Het
Tdrd12 A G 7: 35,185,117 (GRCm39) C718R Het
Tgoln1 G C 6: 72,593,261 (GRCm39) T73R probably benign Het
Tmbim1 T C 1: 74,330,438 (GRCm39) E185G probably benign Het
Tyk2 T C 9: 21,019,330 (GRCm39) M1031V probably damaging Het
Vmn1r71 C T 7: 10,482,428 (GRCm39) V87I not run Het
Vmn2r49 A G 7: 9,720,741 (GRCm39) V250A probably benign Het
Yipf3 A C 17: 46,561,753 (GRCm39) T187P probably damaging Het
Zfp148 G T 16: 33,255,160 (GRCm39) R50L possibly damaging Het
Zfp628 G A 7: 4,924,817 (GRCm39) G1013E probably damaging Het
Other mutations in Ets1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Ets1 APN 9 32,664,222 (GRCm39) intron probably benign
IGL00899:Ets1 APN 9 32,664,104 (GRCm39) missense probably damaging 1.00
IGL01615:Ets1 APN 9 32,644,235 (GRCm39) splice site probably benign
IGL01867:Ets1 APN 9 32,645,455 (GRCm39) missense probably damaging 0.99
IGL02424:Ets1 APN 9 32,665,589 (GRCm39) nonsense probably null
IGL03204:Ets1 APN 9 32,644,308 (GRCm39) missense possibly damaging 0.64
Chamois UTSW 9 32,649,614 (GRCm39) missense probably damaging 1.00
Ecru UTSW 9 32,645,256 (GRCm39) nonsense probably null
Fawn UTSW 9 32,664,153 (GRCm39) nonsense probably null
R0479:Ets1 UTSW 9 32,641,476 (GRCm39) missense probably damaging 1.00
R0659:Ets1 UTSW 9 32,649,589 (GRCm39) missense probably damaging 1.00
R0839:Ets1 UTSW 9 32,645,357 (GRCm39) nonsense probably null
R5009:Ets1 UTSW 9 32,644,295 (GRCm39) missense possibly damaging 0.85
R5590:Ets1 UTSW 9 32,640,094 (GRCm39) splice site probably benign
R6367:Ets1 UTSW 9 32,645,256 (GRCm39) nonsense probably null
R6423:Ets1 UTSW 9 32,649,611 (GRCm39) missense probably damaging 0.97
R6517:Ets1 UTSW 9 32,664,093 (GRCm39) critical splice acceptor site probably null
R6584:Ets1 UTSW 9 32,645,293 (GRCm39) missense probably damaging 1.00
R7414:Ets1 UTSW 9 32,664,153 (GRCm39) nonsense probably null
R7688:Ets1 UTSW 9 32,607,720 (GRCm39) missense probably benign 0.10
R8730:Ets1 UTSW 9 32,649,614 (GRCm39) missense probably damaging 1.00
R8747:Ets1 UTSW 9 32,641,474 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCTGTAGTGTGCTTACAGAC -3'
(R):5'- TCCCACTCGCAGGAACTTTG -3'

Sequencing Primer
(F):5'- AAAAATCGGTTGAGATTGTTGGG -3'
(R):5'- CACTCGCAGGAACTTTGTAGACTG -3'
Posted On 2019-11-04