Incidental Mutation 'R7327:Cfap46'
ID591007
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7327 (G1)
Quality Score138.008
Status Validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 139635146 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
Predicted Effect probably null
Transcript: ENSMUST00000129990
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,548,680 T3I probably benign Het
Ahi1 T A 10: 20,987,077 V717E probably damaging Het
Anapc4 A G 5: 52,845,330 T238A probably damaging Het
Arhgap27 A T 11: 103,360,541 C120* probably null Het
Bdp1 A T 13: 100,041,532 V1943D probably damaging Het
Cdc14b A G 13: 64,225,647 V141A probably damaging Het
Cgnl1 C A 9: 71,725,883 R62L possibly damaging Het
Chaf1a A G 17: 56,062,573 S522G probably benign Het
Cox19 A G 5: 139,342,647 F37S probably damaging Het
Csmd1 G A 8: 16,058,707 S1894L probably damaging Het
Cyp4a12a A T 4: 115,327,559 R346W probably damaging Het
Dip2a A C 10: 76,272,562 C1315G probably benign Het
Dmxl2 A C 9: 54,401,585 W1961G probably damaging Het
Dst T C 1: 34,201,405 L1945P probably damaging Het
Efr3a A G 15: 65,819,778 S92G probably damaging Het
Ep300 C T 15: 81,627,314 T865I unknown Het
Ercc6 A G 14: 32,526,404 E304G probably benign Het
Filip1l A C 16: 57,570,937 E629D probably damaging Het
Frem1 G A 4: 83,020,755 T30I possibly damaging Het
Glb1 T C 9: 114,417,058 F59S probably benign Het
Gli3 T C 13: 15,725,559 L1177P probably benign Het
Gm16486 T A 8: 70,716,804 M1181K possibly damaging Het
Gpatch2l A G 12: 86,256,872 T223A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Hmcn1 A T 1: 150,603,814 M4633K probably benign Het
Hoxc8 T A 15: 102,991,110 Y111N probably damaging Het
Ifi207 A G 1: 173,729,015 L726P probably benign Het
Iqgap2 T A 13: 95,635,655 M1339L probably benign Het
Kif21b A G 1: 136,159,649 Q901R possibly damaging Het
Krtap4-8 C A 11: 99,780,408 C79F unknown Het
Ldb3 T C 14: 34,571,802 N155S probably damaging Het
Mad2l1 T A 6: 66,539,810 V162E probably benign Het
Map7 T A 10: 20,233,462 V87E unknown Het
Mndal A T 1: 173,875,619 D73E unknown Het
Msantd1 T C 5: 34,917,695 S34P probably damaging Het
Myh14 T C 7: 44,611,553 Q1838R possibly damaging Het
Myh15 G T 16: 49,173,006 R1668L possibly damaging Het
Ncoa7 A G 10: 30,689,800 M666T probably damaging Het
Nol6 A T 4: 41,116,686 L944Q probably benign Het
Olfr197 A T 16: 59,186,013 F157I unknown Het
Orc1 A G 4: 108,588,714 T10A probably benign Het
Pcp4l1 G A 1: 171,174,465 A42V possibly damaging Het
Pglyrp2 C T 17: 32,415,919 A490T probably benign Het
Pirb A T 7: 3,717,188 C395* probably null Het
Ppp1r11 T C 17: 36,951,008 R12G possibly damaging Het
Prlr A G 15: 10,346,438 D290G probably benign Het
Ptpn21 G T 12: 98,680,101 R1033S probably damaging Het
Rad54l2 A G 9: 106,693,461 L1220P possibly damaging Het
Rufy3 G A 5: 88,642,952 R504H probably damaging Het
Scgb2b21 C T 7: 33,519,905 V25I probably benign Het
Sh3bgrl2 T C 9: 83,548,489 S11P possibly damaging Het
Slain2 A T 5: 72,974,659 T498S probably benign Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc30a9 A T 5: 67,342,119 I307F probably damaging Het
Snap91 C T 9: 86,773,545 G800R unknown Het
Tnc G T 4: 63,964,762 probably null Het
Trav21-dv12 T C 14: 53,876,057 probably benign Het
Txk A T 5: 72,715,883 I228N probably damaging Het
Vac14 T C 8: 110,711,620 Y622H probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr35 T G 12: 8,987,312 M306R probably benign Het
Zan A T 5: 137,465,232 S562T probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGGGTTTCCTCAGAGCTGC -3'
(R):5'- TGAACGTCAGAGAAAATTGTCACC -3'

Sequencing Primer
(F):5'- AGAGCTGCCCTTGCCAAC -3'
(R):5'- TTTTATAGAACCCCAGAGCAGG -3'
Posted On2019-11-04