Incidental Mutation 'R7335:Arpp21'
ID591012
Institutional Source Beutler Lab
Gene Symbol Arpp21
Ensembl Gene ENSMUSG00000032503
Gene Namecyclic AMP-regulated phosphoprotein, 21
SynonymsARPP-21, 0710001E13Rik, Tarpp, D9Bwg1012e, R3hdm3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7335 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location112065091-112235938 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 112176251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035085] [ENSMUST00000070218] [ENSMUST00000111872] [ENSMUST00000159055] [ENSMUST00000159246] [ENSMUST00000159451] [ENSMUST00000160478] [ENSMUST00000161097] [ENSMUST00000161412] [ENSMUST00000162065] [ENSMUST00000162097] [ENSMUST00000162796] [ENSMUST00000164754] [ENSMUST00000172380] [ENSMUST00000178410]
Predicted Effect probably null
Transcript: ENSMUST00000035085
SMART Domains Protein: ENSMUSP00000035085
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 282 297 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 459 482 N/A INTRINSIC
low complexity region 490 503 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000070218
SMART Domains Protein: ENSMUSP00000069264
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111872
SMART Domains Protein: ENSMUSP00000107503
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159055
SMART Domains Protein: ENSMUSP00000123883
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159246
SMART Domains Protein: ENSMUSP00000123715
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 260 274 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159451
SMART Domains Protein: ENSMUSP00000125095
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 233 248 N/A INTRINSIC
low complexity region 299 319 N/A INTRINSIC
low complexity region 410 433 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160478
SMART Domains Protein: ENSMUSP00000124550
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161097
SMART Domains Protein: ENSMUSP00000123937
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161412
SMART Domains Protein: ENSMUSP00000125282
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162065
SMART Domains Protein: ENSMUSP00000125684
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162097
SMART Domains Protein: ENSMUSP00000124502
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162796
SMART Domains Protein: ENSMUSP00000124670
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164754
SMART Domains Protein: ENSMUSP00000125862
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172380
SMART Domains Protein: ENSMUSP00000130558
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178410
SMART Domains Protein: ENSMUSP00000136769
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mice are viable and display normal brain anatomy and no obvious behavioral or morphological defects. However, in medium spiny neurons from mutant mice, the ability of both M1 and D2 receptor activation to modulate L-type calcium channel currents is enhanced by nearly 2-fold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,602,266 S35G probably benign Het
Adcy6 G T 15: 98,603,876 Q286K probably benign Het
Agrn A G 4: 156,176,532 S676P probably damaging Het
Arntl2 A G 6: 146,809,719 M74V probably benign Het
C1rb A T 6: 124,575,279 I319F possibly damaging Het
C2cd3 T C 7: 100,422,603 V629A Het
Cacna1i T G 15: 80,375,575 F1287C probably damaging Het
Catspere2 A G 1: 178,098,508 I247V probably benign Het
Cd101 C G 3: 101,018,729 A229P probably benign Het
Cdh23 T C 10: 60,305,116 D3151G probably damaging Het
Cenpc1 C A 5: 86,034,353 K557N possibly damaging Het
Col6a4 G A 9: 106,076,892 T416M possibly damaging Het
Cyp2c67 A T 19: 39,640,007 C164* probably null Het
Dopey2 A G 16: 93,747,508 E179G probably benign Het
Duoxa2 A T 2: 122,301,340 Y170F possibly damaging Het
Fras1 A G 5: 96,736,970 K2569R possibly damaging Het
Fsip2 C A 2: 82,983,118 H3260Q probably benign Het
Gm3402 T C 5: 146,515,233 I121T probably benign Het
Herc3 T A 6: 58,876,788 H606Q possibly damaging Het
Hmcn2 T C 2: 31,392,157 V1927A possibly damaging Het
Hnf4g A G 3: 3,652,864 H347R possibly damaging Het
Hs3st3a1 A G 11: 64,520,337 T234A probably benign Het
Hyal1 G T 9: 107,579,160 V379L probably benign Het
Ighv1-19 A G 12: 114,708,951 probably benign Het
Iqcc T A 4: 129,616,708 Q338L not run Het
Kdm5b T C 1: 134,560,439 V34A probably damaging Het
Lgals4 T C 7: 28,841,146 F225L probably benign Het
Lmtk3 C T 7: 45,795,157 T1088I unknown Het
Magel2 A T 7: 62,380,776 S1143C unknown Het
Mapk4 A T 18: 73,937,267 L185Q possibly damaging Het
Ncam1 A G 9: 49,506,911 S1030P Het
Nynrin A T 14: 55,863,914 T347S probably benign Het
Pak7 T C 2: 136,098,299 T532A probably damaging Het
Pcdhb15 A G 18: 37,474,336 E207G probably damaging Het
Pde6h T C 6: 136,963,213 W66R probably damaging Het
Pmaip1 T C 18: 66,458,814 probably null Het
Prkd3 A G 17: 78,954,566 F774S probably damaging Het
Prox1 T A 1: 190,161,845 R134S possibly damaging Het
Ptpn22 T A 3: 103,886,019 H495Q probably damaging Het
Ptprj G T 2: 90,440,782 Q1201K probably benign Het
Rp1l1 A G 14: 64,031,998 S1678G probably benign Het
Sez6l G T 5: 112,576,812 probably null Het
Sgcg T A 14: 61,240,367 Y91F probably damaging Het
Skint2 C T 4: 112,624,218 L93F probably damaging Het
Slc22a22 A T 15: 57,263,375 D99E probably benign Het
Slco3a1 A G 7: 74,284,342 I694T probably damaging Het
Smurf2 A T 11: 106,846,085 I305N possibly damaging Het
Soga1 T C 2: 157,031,005 Q862R possibly damaging Het
Stac3 T A 10: 127,504,900 V178D probably benign Het
Suclg2 T A 6: 95,566,460 N330I probably damaging Het
Suclg2 G A 6: 95,566,463 A329V probably damaging Het
Tas2r118 C T 6: 23,969,750 C104Y probably damaging Het
Tom1l2 T G 11: 60,245,165 E327D probably benign Het
Trit1 T C 4: 123,016,779 M57T possibly damaging Het
Vav1 G A 17: 57,296,720 S134N probably benign Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Zfp735 T A 11: 73,711,553 V441E possibly damaging Het
Other mutations in Arpp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Arpp21 APN 9 112176123 missense probably damaging 1.00
IGL02369:Arpp21 APN 9 112119198 missense probably benign
IGL02516:Arpp21 APN 9 112185661 missense probably damaging 1.00
IGL02687:Arpp21 APN 9 112065815 nonsense probably null
IGL02698:Arpp21 APN 9 112185744 utr 5 prime probably benign
IGL02948:Arpp21 APN 9 112176200 missense probably damaging 1.00
Noom UTSW 9 112176251 splice site probably null
R0040:Arpp21 UTSW 9 112147409 splice site probably benign
R0533:Arpp21 UTSW 9 112126505 missense probably benign 0.36
R0636:Arpp21 UTSW 9 112183498 missense probably benign 0.30
R0696:Arpp21 UTSW 9 112183589 splice site probably null
R0707:Arpp21 UTSW 9 112157756 missense probably benign 0.25
R0970:Arpp21 UTSW 9 112136448 splice site probably benign
R1300:Arpp21 UTSW 9 112143374 missense probably damaging 1.00
R1416:Arpp21 UTSW 9 112179129 missense probably damaging 1.00
R1713:Arpp21 UTSW 9 112067169 missense probably damaging 1.00
R1803:Arpp21 UTSW 9 112127398 missense possibly damaging 0.61
R1884:Arpp21 UTSW 9 112143527 missense probably damaging 1.00
R1918:Arpp21 UTSW 9 112119178 splice site probably benign
R1992:Arpp21 UTSW 9 112157793 missense probably damaging 0.97
R2121:Arpp21 UTSW 9 112136670 missense probably damaging 1.00
R2932:Arpp21 UTSW 9 112179105 missense probably damaging 1.00
R3729:Arpp21 UTSW 9 112065979 missense possibly damaging 0.76
R3964:Arpp21 UTSW 9 112065776 missense probably damaging 1.00
R4130:Arpp21 UTSW 9 112155308 intron probably benign
R4131:Arpp21 UTSW 9 112155308 intron probably benign
R4514:Arpp21 UTSW 9 112177677 missense probably damaging 0.99
R4789:Arpp21 UTSW 9 112067292 missense probably benign 0.02
R5138:Arpp21 UTSW 9 112179084 missense probably damaging 1.00
R5218:Arpp21 UTSW 9 112143431 missense probably damaging 1.00
R5371:Arpp21 UTSW 9 112065932 missense probably benign 0.01
R5373:Arpp21 UTSW 9 112067268 missense probably benign
R5407:Arpp21 UTSW 9 112116753 intron probably benign
R5528:Arpp21 UTSW 9 112149353 missense probably benign 0.04
R5957:Arpp21 UTSW 9 112185686 missense probably benign 0.01
R5992:Arpp21 UTSW 9 112143485 nonsense probably null
R6166:Arpp21 UTSW 9 112119198 missense probably benign
R6294:Arpp21 UTSW 9 112127452 missense probably damaging 0.99
R6632:Arpp21 UTSW 9 112127356 nonsense probably null
R6952:Arpp21 UTSW 9 112126482 missense probably damaging 0.98
R7083:Arpp21 UTSW 9 112183544 missense probably benign 0.22
R7089:Arpp21 UTSW 9 112126446 missense probably benign 0.23
R7813:Arpp21 UTSW 9 112179065 missense probably damaging 0.97
R8090:Arpp21 UTSW 9 112116701 missense unknown
R8204:Arpp21 UTSW 9 112136570 missense noncoding transcript
R8397:Arpp21 UTSW 9 112149372 missense possibly damaging 0.79
X0013:Arpp21 UTSW 9 112179160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGACTTACATCCTGGTGC -3'
(R):5'- TCCTGAACTAACCCAGAACACTTTG -3'

Sequencing Primer
(F):5'- GACTTACATCCTGGTGCTGCTG -3'
(R):5'- TGAGAAACAGCAATGCCTACTG -3'
Posted On2019-11-04