Incidental Mutation 'R7314:Phkb'
ID591015
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Namephosphorylase kinase beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R7314 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85840959-86061376 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 85942392 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771]
Predicted Effect probably null
Transcript: ENSMUST00000053771
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A G 14: 35,811,649 V54A probably benign Het
Abcc10 C A 17: 46,315,404 A704S probably damaging Het
Adss A G 1: 177,767,751 W408R probably damaging Het
Aplp1 T C 7: 30,435,989 E548G probably damaging Het
C4b C T 17: 34,740,356 V415I probably benign Het
Celsr3 T C 9: 108,829,144 V942A probably damaging Het
Cstf1 A G 2: 172,373,034 D25G probably damaging Het
Dnah14 A T 1: 181,785,254 probably null Het
Dnah9 G A 11: 65,989,851 T2640I probably benign Het
Dnase2b T C 3: 146,582,396 I315V probably damaging Het
Endod1 T C 9: 14,356,999 S397G probably benign Het
Eps8 A G 6: 137,527,092 V171A possibly damaging Het
Ghdc T C 11: 100,769,102 E273G probably damaging Het
Gm10282 C T 8: 72,304,995 G63R probably damaging Het
Hspbap1 T A 16: 35,825,171 S409T probably benign Het
Ireb2 T C 9: 54,892,510 Y412H probably damaging Het
Jph4 TCCATTCTCGTATACCCCA TCCA 14: 55,109,739 probably benign Het
Klhl6 A G 16: 19,957,005 Y268H probably damaging Het
Krt16 T C 11: 100,247,869 D197G probably damaging Het
Lca5 T C 9: 83,395,510 K594E possibly damaging Het
Lgi3 T C 14: 70,532,112 F84S probably damaging Het
Lingo3 T C 10: 80,834,873 I408V possibly damaging Het
Map3k7 G T 4: 31,985,769 E231* probably null Het
Nrip1 A G 16: 76,291,190 S1160P probably benign Het
Oas1g A T 5: 120,878,463 L301Q probably damaging Het
Obox3 T A 7: 15,627,154 Q62L possibly damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr524 A T 7: 140,202,413 V119D probably damaging Het
Parp8 G T 13: 116,868,460 F727L probably benign Het
Pcdha1 T C 18: 36,931,500 Y406H probably damaging Het
Pcdhgb8 A G 18: 37,762,999 D374G probably damaging Het
Pdzd8 A T 19: 59,301,351 L539* probably null Het
Ppp1r13b T C 12: 111,846,356 E143G probably damaging Het
Rpap2 T C 5: 107,620,379 V361A probably damaging Het
Setd4 T C 16: 93,587,823 T326A probably benign Het
Smad9 A G 3: 54,789,323 N270D probably benign Het
Sntg2 A G 12: 30,267,108 S172P probably benign Het
Tecpr1 A G 5: 144,217,332 L101P probably damaging Het
Thap8 G A 7: 30,289,895 V177I unknown Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmprss11f T C 5: 86,524,053 T427A possibly damaging Het
Trhr2 A G 8: 122,358,750 V165A possibly damaging Het
Ubr3 T A 2: 69,991,600 L1402Q probably damaging Het
Vps13c T A 9: 67,943,340 probably null Het
Zfp369 T C 13: 65,292,104 S201P probably damaging Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 85957587 missense probably benign 0.42
IGL01126:Phkb APN 8 85946101 missense probably benign 0.12
IGL01700:Phkb APN 8 86017465 missense probably benign 0.06
IGL01761:Phkb APN 8 86019064 missense probably benign 0.01
IGL02404:Phkb APN 8 85878115 missense possibly damaging 0.94
IGL02672:Phkb APN 8 85942358 missense probably benign
IGL02682:Phkb APN 8 85875646 makesense probably null
IGL02693:Phkb APN 8 85942234 missense probably damaging 1.00
IGL02798:Phkb APN 8 86043777 missense probably benign
IGL02888:Phkb APN 8 85935472 critical splice donor site probably null
IGL03106:Phkb APN 8 86018466 splice site probably benign
PIT4544001:Phkb UTSW 8 86011637 missense probably benign 0.42
R0088:Phkb UTSW 8 85942391 critical splice donor site probably null
R0107:Phkb UTSW 8 86016931 missense probably benign 0.01
R0504:Phkb UTSW 8 86056524 missense probably benign
R0569:Phkb UTSW 8 86017402 missense probably damaging 1.00
R0671:Phkb UTSW 8 85875693 missense probably damaging 0.97
R0894:Phkb UTSW 8 86017441 missense probably damaging 1.00
R1491:Phkb UTSW 8 85875657 missense possibly damaging 0.90
R1502:Phkb UTSW 8 86059339 missense possibly damaging 0.69
R1595:Phkb UTSW 8 86026553 splice site probably benign
R1686:Phkb UTSW 8 86021649 missense probably benign
R1913:Phkb UTSW 8 85901920 missense possibly damaging 0.95
R1919:Phkb UTSW 8 85922161 missense probably benign 0.17
R1968:Phkb UTSW 8 85970951 missense probably benign 0.07
R2008:Phkb UTSW 8 86056467 missense probably damaging 1.00
R2051:Phkb UTSW 8 86049821 critical splice donor site probably null
R2148:Phkb UTSW 8 86017486 missense probably damaging 0.96
R2305:Phkb UTSW 8 86043802 missense possibly damaging 0.80
R3801:Phkb UTSW 8 85922229 nonsense probably null
R3804:Phkb UTSW 8 85922229 nonsense probably null
R4159:Phkb UTSW 8 86021533 splice site probably null
R4624:Phkb UTSW 8 85848712 intron probably benign
R4833:Phkb UTSW 8 85901911 missense probably damaging 1.00
R5017:Phkb UTSW 8 86049809 missense probably benign
R5169:Phkb UTSW 8 85896491 missense probably benign 0.01
R5337:Phkb UTSW 8 85878245 missense probably damaging 1.00
R5391:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5395:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5480:Phkb UTSW 8 85922182 missense probably damaging 1.00
R5538:Phkb UTSW 8 85922127 missense possibly damaging 0.80
R5623:Phkb UTSW 8 85843048 unclassified probably benign
R5753:Phkb UTSW 8 85878230 missense probably damaging 1.00
R5909:Phkb UTSW 8 86021447 critical splice donor site probably null
R5929:Phkb UTSW 8 85970914 missense probably benign 0.01
R6093:Phkb UTSW 8 85942329 missense probably damaging 1.00
R6320:Phkb UTSW 8 85875698 missense probably benign 0.00
R6324:Phkb UTSW 8 86018542 missense probably benign 0.00
R6626:Phkb UTSW 8 85922151 missense probably damaging 0.96
R6687:Phkb UTSW 8 86029546 missense probably damaging 1.00
R6848:Phkb UTSW 8 86029617 missense probably damaging 0.99
R7228:Phkb UTSW 8 85843007 unclassified probably benign
R7260:Phkb UTSW 8 85878130 missense probably benign 0.07
R7271:Phkb UTSW 8 86043789 missense probably damaging 1.00
R7586:Phkb UTSW 8 86029597 missense probably damaging 1.00
R7654:Phkb UTSW 8 85940887 missense possibly damaging 0.91
R7958:Phkb UTSW 8 86021663 missense probably benign 0.00
R8269:Phkb UTSW 8 86029582 missense probably benign 0.42
X0021:Phkb UTSW 8 86029635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGTTACCCTGCGTTTGC -3'
(R):5'- TGAATCTATGTGGCCACTTTGG -3'

Sequencing Primer
(F):5'- TGCCTTGGATGATGAAGCAC -3'
(R):5'- ATCTATGTGGCCACTTTGGTAAGAAG -3'
Posted On2019-11-08