Incidental Mutation 'R7338:Lrrc9'
ID591022
Institutional Source Beutler Lab
Gene Symbol Lrrc9
Ensembl Gene ENSMUSG00000021090
Gene Nameleucine rich repeat containing 9
Synonyms4930432K16Rik, 4921529O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7338 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location72441866-72530750 bp(+) (GRCm38)
Type of Mutationintron (30 bp from exon)
DNA Base Change (assembly) C to T at 72463531 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000221360]
Predicted Effect probably null
Transcript: ENSMUST00000161284
SMART Domains Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090

DomainStartEndE-ValueType
Pfam:LRR_4 77 118 2.8e-11 PFAM
LRR 119 140 8.49e1 SMART
LRR 141 164 2.27e1 SMART
LRR 165 187 2.09e2 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 706 727 1.41e2 SMART
LRR 728 749 6.78e1 SMART
LRR 750 773 7.17e1 SMART
LRRcap 793 811 2.26e2 SMART
LRR 943 966 2.67e-1 SMART
LRR 967 992 1.22e1 SMART
LRRcap 1031 1049 4.37e0 SMART
low complexity region 1109 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162159
SMART Domains Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090

DomainStartEndE-ValueType
LRR 53 74 5.39e2 SMART
LRR 75 96 1.14e2 SMART
LRR 97 118 7.9e-4 SMART
LRR 119 140 2.75e-3 SMART
LRR 141 164 2.27e1 SMART
LRR 164 185 1.87e1 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 705 726 1.41e2 SMART
LRR 727 748 6.78e1 SMART
LRR 749 771 1.37e1 SMART
LRRcap 792 810 2.26e2 SMART
LRR 898 919 2.62e1 SMART
LRR 920 941 5.17e1 SMART
LRR 942 965 2.67e-1 SMART
LRR 966 991 1.22e1 SMART
LRR 1013 1032 4.42e2 SMART
LRRcap 1030 1048 4.37e0 SMART
low complexity region 1108 1119 N/A INTRINSIC
LRR 1128 1150 2.4e1 SMART
LRR 1191 1209 5.7e2 SMART
LRR 1215 1236 1.03e-2 SMART
LRR 1237 1260 8.48e0 SMART
LRR 1283 1304 2.67e-1 SMART
Blast:LRR 1308 1333 4e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000221360
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Arhgap28 T C 17: 67,896,111 R166G probably damaging Het
Bcan T A 3: 87,994,243 E384V probably damaging Het
Bcl9l A G 9: 44,508,708 N1137S probably benign Het
Caprin1 A G 2: 103,779,423 L170S probably benign Het
Card6 C T 15: 5,099,872 E681K probably benign Het
Catsperb G A 12: 101,480,984 V248I probably benign Het
Ccnj T A 19: 40,837,033 H62Q probably damaging Het
Cd180 A C 13: 102,706,428 I661L probably benign Het
Cdk11b A G 4: 155,647,551 R473G unknown Het
Cep126 T C 9: 8,099,798 T912A possibly damaging Het
Chek2 T A 5: 110,873,514 V530E probably benign Het
Chga G T 12: 102,562,841 S359I probably damaging Het
Cnrip1 T C 11: 17,054,657 V69A probably damaging Het
Cyp2a5 A T 7: 26,842,947 Q458L probably damaging Het
Cyp2j11 T A 4: 96,307,287 T391S possibly damaging Het
Dhx16 T C 17: 35,888,144 L794P probably damaging Het
Dscaml1 A G 9: 45,674,504 T580A probably benign Het
Elmo1 A T 13: 20,280,812 I184L probably benign Het
Gabra1 C T 11: 42,182,294 G51S unknown Het
Gabrr3 C A 16: 59,448,076 L351I possibly damaging Het
Gbp7 A T 3: 142,538,025 N111I probably damaging Het
Gjd2 C T 2: 114,011,102 R298H probably damaging Het
Gm5930 T C 14: 44,336,457 Y141C probably damaging Het
Grin3a G T 4: 49,771,238 N511K probably benign Het
Hdac7 T C 15: 97,810,022 D122G probably benign Het
Ifi204 G A 1: 173,760,137 T152I possibly damaging Het
Med21 T A 6: 146,642,584 probably benign Het
Mmp19 A T 10: 128,799,083 T523S probably benign Het
Nav3 G A 10: 109,769,212 T1000I probably benign Het
Nin T C 12: 70,044,064 D859G Het
Nip7 T G 8: 107,057,284 L52R possibly damaging Het
Olfr1039 A T 2: 86,131,382 F94I probably damaging Het
Olfr524 A T 7: 140,202,533 V79E probably benign Het
Olfr934 A G 9: 38,982,520 Y175H probably damaging Het
Otop1 T A 5: 38,300,203 Y435* probably null Het
Pak4 A G 7: 28,564,956 S174P probably benign Het
Pcsk7 G A 9: 45,925,989 R537Q probably benign Het
Podxl G A 6: 31,529,006 S34F unknown Het
Prr36 G A 8: 4,216,212 R113C probably damaging Het
Ptk7 T C 17: 46,579,599 I436V probably benign Het
Slc13a5 C T 11: 72,266,484 V28I probably benign Het
Slc9a3r2 T A 17: 24,650,208 probably benign Het
Slco6d1 A T 1: 98,421,372 D56V probably benign Het
Spg11 G A 2: 122,055,377 R2317W probably damaging Het
Stom T A 2: 35,323,748 probably null Het
Svs5 T C 2: 164,332,808 L8P possibly damaging Het
Tmem141 C A 2: 25,621,614 V39F probably damaging Het
Tmprss6 A G 15: 78,459,819 L181P probably damaging Het
Tnni3 A G 7: 4,521,380 S40P probably benign Het
Tubgcp4 A G 2: 121,193,984 I548V probably benign Het
Twf2 A G 9: 106,203,939 probably benign Het
Wnt5b C A 6: 119,448,131 probably null Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Yipf4 T G 17: 74,489,776 S21A probably benign Het
Zscan20 A G 4: 128,588,150 M573T probably benign Het
Other mutations in Lrrc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Lrrc9 APN 12 72486243 missense possibly damaging 0.63
IGL00843:Lrrc9 APN 12 72463417 missense possibly damaging 0.78
IGL01923:Lrrc9 APN 12 72510412 missense possibly damaging 0.93
IGL02027:Lrrc9 APN 12 72470334 splice site probably benign
IGL02271:Lrrc9 APN 12 72510381 missense probably benign 0.06
IGL02398:Lrrc9 APN 12 72466903 missense probably benign
IGL02795:Lrrc9 APN 12 72478768 missense probably damaging 1.00
IGL02931:Lrrc9 APN 12 72454149 missense probably damaging 1.00
IGL03257:Lrrc9 APN 12 72449768 missense probably benign
BB006:Lrrc9 UTSW 12 72486297 missense possibly damaging 0.92
BB016:Lrrc9 UTSW 12 72486297 missense possibly damaging 0.92
IGL02799:Lrrc9 UTSW 12 72506404 missense probably damaging 1.00
R0172:Lrrc9 UTSW 12 72463486 missense possibly damaging 0.50
R0315:Lrrc9 UTSW 12 72456028 missense probably damaging 0.96
R0492:Lrrc9 UTSW 12 72478763 missense possibly damaging 0.47
R0617:Lrrc9 UTSW 12 72483014 missense probably damaging 1.00
R0639:Lrrc9 UTSW 12 72486288 missense probably damaging 1.00
R0987:Lrrc9 UTSW 12 72510382 missense probably benign 0.00
R1325:Lrrc9 UTSW 12 72497104 missense probably damaging 0.99
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1479:Lrrc9 UTSW 12 72460825 nonsense probably null
R1564:Lrrc9 UTSW 12 72487053 missense probably damaging 1.00
R1626:Lrrc9 UTSW 12 72495661 unclassified probably null
R1632:Lrrc9 UTSW 12 72460020 splice site probably null
R1715:Lrrc9 UTSW 12 72477299 missense probably damaging 1.00
R1743:Lrrc9 UTSW 12 72456117 missense probably damaging 1.00
R1779:Lrrc9 UTSW 12 72455998 nonsense probably null
R1866:Lrrc9 UTSW 12 72497138 missense probably damaging 0.97
R1878:Lrrc9 UTSW 12 72476164 critical splice donor site probably null
R1990:Lrrc9 UTSW 12 72497861 missense probably damaging 0.99
R2361:Lrrc9 UTSW 12 72463470 missense possibly damaging 0.52
R3752:Lrrc9 UTSW 12 72460806 nonsense probably null
R3833:Lrrc9 UTSW 12 72482991 missense probably damaging 1.00
R4134:Lrrc9 UTSW 12 72466966 missense probably benign 0.00
R4651:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4652:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4659:Lrrc9 UTSW 12 72470264 missense probably damaging 1.00
R4831:Lrrc9 UTSW 12 72499679 missense probably damaging 1.00
R4857:Lrrc9 UTSW 12 72499692 missense possibly damaging 0.94
R5017:Lrrc9 UTSW 12 72506325 missense possibly damaging 0.86
R5163:Lrrc9 UTSW 12 72449389 missense probably damaging 1.00
R5279:Lrrc9 UTSW 12 72495594 missense possibly damaging 0.80
R5434:Lrrc9 UTSW 12 72454088 missense probably damaging 0.98
R5783:Lrrc9 UTSW 12 72456053 missense possibly damaging 0.62
R6021:Lrrc9 UTSW 12 72469231 missense probably damaging 0.97
R6214:Lrrc9 UTSW 12 72459853 missense probably damaging 1.00
R6255:Lrrc9 UTSW 12 72487023 missense probably benign 0.33
R6538:Lrrc9 UTSW 12 72500929 missense probably benign 0.08
R6563:Lrrc9 UTSW 12 72486395 splice site probably null
R6672:Lrrc9 UTSW 12 72473936 missense possibly damaging 0.88
R6919:Lrrc9 UTSW 12 72506393 missense probably benign 0.01
R6929:Lrrc9 UTSW 12 72450772 missense probably benign 0.41
R7092:Lrrc9 UTSW 12 72463464 missense possibly damaging 0.81
R7150:Lrrc9 UTSW 12 72466952 missense probably benign 0.00
R7398:Lrrc9 UTSW 12 72500816 missense probably damaging 0.98
R7477:Lrrc9 UTSW 12 72503527 critical splice donor site probably null
R7501:Lrrc9 UTSW 12 72449716 missense probably damaging 1.00
R7542:Lrrc9 UTSW 12 72506320 missense probably damaging 0.96
R7816:Lrrc9 UTSW 12 72495692 missense probably damaging 1.00
R7870:Lrrc9 UTSW 12 72486190 missense probably damaging 0.99
R7929:Lrrc9 UTSW 12 72486297 missense possibly damaging 0.92
R8042:Lrrc9 UTSW 12 72460906 missense probably benign 0.02
R8108:Lrrc9 UTSW 12 72454059 missense probably damaging 1.00
R8192:Lrrc9 UTSW 12 72449389 missense probably damaging 1.00
R8244:Lrrc9 UTSW 12 72499610 missense probably benign 0.22
X0025:Lrrc9 UTSW 12 72497060 missense probably damaging 1.00
Z1176:Lrrc9 UTSW 12 72477393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGCTGTGAACTAATCCTG -3'
(R):5'- CAGTGTCATTAGGACCTCCAGG -3'

Sequencing Primer
(F):5'- GCTGTGAACTAATCCTGTCGCG -3'
(R):5'- TCATGAAGTCATCTCGGC -3'
Posted On2019-11-08