Mutagenetix > Incidental Mutations

Incidental Mutation 'R7376:Cep104'

591028

Institutional Source

Beutler Lab

Gene Symbol

Cep104

Ensembl Gene

ENSMUSG00000039523

Gene Name

centrosomal protein 104

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.194) question?

Stock #

R7376 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153975194-154008732 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 153983052 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000040762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047497]

Predicted Effect

probably null
Transcript: ENSMUST00000047497

SMART Domains

Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523

Domain	Start	End	E-Value	Type
coiled coil region	222	249	N/A	INTRINSIC
low complexity region	288	301	N/A	INTRINSIC
low complexity region	307	320	N/A	INTRINSIC
SCOP:d1gw5b_	523	646	3e-5	SMART
coiled coil region	688	730	N/A	INTRINSIC
low complexity region	889	903	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,291,118	I994V	probably benign	Het
Acan	T	G	7: 79,088,307		probably null	Het
Adamts12	G	A	15: 11,277,339	V680I	possibly damaging	Het
Adgrg7	T	C	16: 56,724,979	I712V	probably damaging	Het
Adgrl3	A	G	5: 81,794,750	H1477R	probably damaging	Het
Adgrv1	T	A	13: 81,518,126	D1937V	probably damaging	Het
Alms1	T	C	6: 85,622,106	S1305P	probably benign	Het
Banp	T	A	8: 121,974,497	M39K	probably damaging	Het
Bbs10	A	G	10: 111,299,250	T75A	probably benign	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
Brinp2	C	T	1: 158,251,368	C295Y	probably damaging	Het
Card11	C	T	5: 140,898,238	V429I	probably benign	Het
Cdca3	G	A	6: 124,832,575	R184H	probably benign	Het
Clspn	A	G	4: 126,590,637	K1196R	possibly damaging	Het
Cntnap5b	A	G	1: 99,967,269	T89A	possibly damaging	Het
Cpne9	A	T	6: 113,290,013	I136L	probably damaging	Het
Crat	T	A	2: 30,406,465	I330F	probably damaging	Het
Ctbp2	G	T	7: 133,013,968	Q413K	possibly damaging	Het
D630045J12Rik	T	C	6: 38,174,303	E1220G	probably damaging	Het
Dap	A	G	15: 31,235,839	D41G	probably damaging	Het
Dnah14	A	G	1: 181,763,402	I3287V	probably benign	Het
Dsp	A	G	13: 38,172,843	H233R	probably damaging	Het
Dst	T	C	1: 34,192,689	I3121T	probably benign	Het
Espnl	T	G	1: 91,322,314	L61R	probably damaging	Het
Evc2	T	C	5: 37,370,639	S331P	possibly damaging	Het
Gars	A	G	6: 55,073,359	E535G	probably benign	Het
Hfm1	A	G	5: 106,895,218	I650T	possibly damaging	Het
Iyd	T	A	10: 3,545,690	I116N	probably damaging	Het
Kif16b	A	G	2: 142,711,872	L1002S	probably damaging	Het
Kif1bp	C	T	10: 62,559,064	V600I	possibly damaging	Het
Lgi1	G	A	19: 38,284,020	G113D	probably damaging	Het
Lgi2	G	A	5: 52,538,262	R452C	probably damaging	Het
Man2b2	T	G	5: 36,813,378	N764T	probably damaging	Het
Mrps18b	A	G	17: 35,910,695	I246T	probably benign	Het
Muc5b	A	G	7: 141,872,550	T4795A	possibly damaging	Het
Mybl2	G	A	2: 163,082,593	G627D	possibly damaging	Het
Ndufb8	C	T	19: 44,555,355	R16K	probably benign	Het
Olfr181	A	T	16: 58,925,758	V271E	possibly damaging	Het
P4htm	C	T	9: 108,580,792	V335M	probably damaging	Het
Pbx3	A	G	2: 34,204,877	I249T	probably damaging	Het
Plod3	G	T	5: 136,990,481	V360L	probably benign	Het
Podxl2	C	T	6: 88,849,650	D161N	probably benign	Het
Polr1b	G	T	2: 129,119,073	V651L	probably benign	Het
Prr14	T	C	7: 127,476,577	S586P	probably benign	Het
Pum3	C	T	19: 27,394,328	G575D	probably benign	Het
Rnf157	C	A	11: 116,360,366	A111S	probably benign	Het
Robo3	A	G	9: 37,432,916	L29P	probably damaging	Het
Smarca5	T	C	8: 80,726,051	N342S	probably damaging	Het
Specc1	T	A	11: 62,118,252	I198K	probably benign	Het
Tmem177	A	T	1: 119,910,014	*312R	probably null	Het
Tom1l2	A	T	11: 60,261,200	M172K	probably benign	Het
Tsc22d4	T	C	5: 137,758,152	V3A	unknown	Het
Uhrf1bp1l	G	A	10: 89,809,656	G1197D	probably damaging	Het
Vmn1r128	G	T	7: 21,349,743	G124V	probably damaging	Het
Vmn1r15	T	C	6: 57,258,357	I70T	probably benign	Het
Vmn2r60	A	G	7: 42,195,207	T665A	probably damaging	Het
Vmn2r83	T	C	10: 79,478,956	F346S	probably benign	Het
Wdr7	T	A	18: 63,777,620	D694E	probably damaging	Het

Other mutations in Cep104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02755:Cep104	APN	4	153996959	missense	possibly damaging	0.93
IGL02884:Cep104	APN	4	153989862	missense	probably damaging	0.96
IGL02928:Cep104	APN	4	153981259	missense	probably benign	0.18
IGL03119:Cep104	APN	4	153981724	missense	probably damaging	1.00
R0409:Cep104	UTSW	4	153983053	splice site	probably benign
R0505:Cep104	UTSW	4	153996304	missense	probably benign	0.00
R0600:Cep104	UTSW	4	154006792	missense	possibly damaging	0.58
R1208:Cep104	UTSW	4	153985379	missense	probably damaging	1.00
R1208:Cep104	UTSW	4	153985379	missense	probably damaging	1.00
R1221:Cep104	UTSW	4	153988445	missense	probably benign	0.00
R1338:Cep104	UTSW	4	153994508	missense	probably benign	0.01
R1528:Cep104	UTSW	4	153994508	missense	probably benign	0.01
R1648:Cep104	UTSW	4	153979096	critical splice donor site	probably null
R1831:Cep104	UTSW	4	154002546	missense	probably benign	0.30
R1832:Cep104	UTSW	4	154002546	missense	probably benign	0.30
R1911:Cep104	UTSW	4	154006798	missense	possibly damaging	0.74
R1914:Cep104	UTSW	4	153989839	missense	possibly damaging	0.79
R2516:Cep104	UTSW	4	153989146	missense	probably damaging	1.00
R2910:Cep104	UTSW	4	153995427	splice site	probably null
R2911:Cep104	UTSW	4	153995427	splice site	probably null
R3751:Cep104	UTSW	4	153981756	missense	probably damaging	1.00
R3828:Cep104	UTSW	4	153984943	missense	probably damaging	1.00
R3829:Cep104	UTSW	4	153984943	missense	probably damaging	1.00
R3830:Cep104	UTSW	4	153984943	missense	probably damaging	1.00
R4474:Cep104	UTSW	4	153989236	missense	possibly damaging	0.47
R4731:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R4732:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R4733:Cep104	UTSW	4	153988426	missense	probably damaging	1.00
R5306:Cep104	UTSW	4	154006242	missense	probably benign	0.02
R5449:Cep104	UTSW	4	153985305	splice site	probably null
R5567:Cep104	UTSW	4	154002277	missense	possibly damaging	0.64
R5761:Cep104	UTSW	4	153981224	missense	possibly damaging	0.63
R5980:Cep104	UTSW	4	153988473	missense	probably benign	0.00
R7003:Cep104	UTSW	4	153993561	missense	probably benign	0.00
R7179:Cep104	UTSW	4	153992867	missense	probably damaging	0.99
X0026:Cep104	UTSW	4	153986885	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTGGAGCATTAGAACATCAG -3'
(R):5'- GCTGCTAACTTCTCTGACAGTC -3'

Sequencing Primer
(F):5'- GAGCATTAGAACATCAGGGCTCTC -3'
(R):5'- TGTAACGAGATCTGATGCCC -3'

Posted On

2019-11-11