Incidental Mutation 'R7376:Cep104'
ID591028
Institutional Source Beutler Lab
Gene Symbol Cep104
Ensembl Gene ENSMUSG00000039523
Gene Namecentrosomal protein 104
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R7376 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location153975194-154008732 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 153983052 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047497]
Predicted Effect probably null
Transcript: ENSMUST00000047497
SMART Domains Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523

DomainStartEndE-ValueType
coiled coil region 222 249 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
SCOP:d1gw5b_ 523 646 3e-5 SMART
coiled coil region 688 730 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,291,118 I994V probably benign Het
Acan T G 7: 79,088,307 probably null Het
Adamts12 G A 15: 11,277,339 V680I possibly damaging Het
Adgrg7 T C 16: 56,724,979 I712V probably damaging Het
Adgrl3 A G 5: 81,794,750 H1477R probably damaging Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Alms1 T C 6: 85,622,106 S1305P probably benign Het
Banp T A 8: 121,974,497 M39K probably damaging Het
Bbs10 A G 10: 111,299,250 T75A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Brinp2 C T 1: 158,251,368 C295Y probably damaging Het
Card11 C T 5: 140,898,238 V429I probably benign Het
Cdca3 G A 6: 124,832,575 R184H probably benign Het
Clspn A G 4: 126,590,637 K1196R possibly damaging Het
Cntnap5b A G 1: 99,967,269 T89A possibly damaging Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crat T A 2: 30,406,465 I330F probably damaging Het
Ctbp2 G T 7: 133,013,968 Q413K possibly damaging Het
D630045J12Rik T C 6: 38,174,303 E1220G probably damaging Het
Dap A G 15: 31,235,839 D41G probably damaging Het
Dnah14 A G 1: 181,763,402 I3287V probably benign Het
Dsp A G 13: 38,172,843 H233R probably damaging Het
Dst T C 1: 34,192,689 I3121T probably benign Het
Espnl T G 1: 91,322,314 L61R probably damaging Het
Evc2 T C 5: 37,370,639 S331P possibly damaging Het
Gars A G 6: 55,073,359 E535G probably benign Het
Hfm1 A G 5: 106,895,218 I650T possibly damaging Het
Iyd T A 10: 3,545,690 I116N probably damaging Het
Kif16b A G 2: 142,711,872 L1002S probably damaging Het
Kif1bp C T 10: 62,559,064 V600I possibly damaging Het
Lgi1 G A 19: 38,284,020 G113D probably damaging Het
Lgi2 G A 5: 52,538,262 R452C probably damaging Het
Man2b2 T G 5: 36,813,378 N764T probably damaging Het
Mrps18b A G 17: 35,910,695 I246T probably benign Het
Muc5b A G 7: 141,872,550 T4795A possibly damaging Het
Mybl2 G A 2: 163,082,593 G627D possibly damaging Het
Ndufb8 C T 19: 44,555,355 R16K probably benign Het
Olfr181 A T 16: 58,925,758 V271E possibly damaging Het
P4htm C T 9: 108,580,792 V335M probably damaging Het
Pbx3 A G 2: 34,204,877 I249T probably damaging Het
Plod3 G T 5: 136,990,481 V360L probably benign Het
Podxl2 C T 6: 88,849,650 D161N probably benign Het
Polr1b G T 2: 129,119,073 V651L probably benign Het
Prr14 T C 7: 127,476,577 S586P probably benign Het
Pum3 C T 19: 27,394,328 G575D probably benign Het
Rnf157 C A 11: 116,360,366 A111S probably benign Het
Robo3 A G 9: 37,432,916 L29P probably damaging Het
Smarca5 T C 8: 80,726,051 N342S probably damaging Het
Specc1 T A 11: 62,118,252 I198K probably benign Het
Tmem177 A T 1: 119,910,014 *312R probably null Het
Tom1l2 A T 11: 60,261,200 M172K probably benign Het
Tsc22d4 T C 5: 137,758,152 V3A unknown Het
Uhrf1bp1l G A 10: 89,809,656 G1197D probably damaging Het
Vmn1r128 G T 7: 21,349,743 G124V probably damaging Het
Vmn1r15 T C 6: 57,258,357 I70T probably benign Het
Vmn2r60 A G 7: 42,195,207 T665A probably damaging Het
Vmn2r83 T C 10: 79,478,956 F346S probably benign Het
Wdr7 T A 18: 63,777,620 D694E probably damaging Het
Other mutations in Cep104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Cep104 APN 4 153996959 missense possibly damaging 0.93
IGL02884:Cep104 APN 4 153989862 missense probably damaging 0.96
IGL02928:Cep104 APN 4 153981259 missense probably benign 0.18
IGL03119:Cep104 APN 4 153981724 missense probably damaging 1.00
R0409:Cep104 UTSW 4 153983053 splice site probably benign
R0505:Cep104 UTSW 4 153996304 missense probably benign 0.00
R0600:Cep104 UTSW 4 154006792 missense possibly damaging 0.58
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1221:Cep104 UTSW 4 153988445 missense probably benign 0.00
R1338:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1528:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1648:Cep104 UTSW 4 153979096 critical splice donor site probably null
R1831:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1832:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1911:Cep104 UTSW 4 154006798 missense possibly damaging 0.74
R1914:Cep104 UTSW 4 153989839 missense possibly damaging 0.79
R2516:Cep104 UTSW 4 153989146 missense probably damaging 1.00
R2910:Cep104 UTSW 4 153995427 splice site probably null
R2911:Cep104 UTSW 4 153995427 splice site probably null
R3751:Cep104 UTSW 4 153981756 missense probably damaging 1.00
R3828:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3829:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3830:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R4474:Cep104 UTSW 4 153989236 missense possibly damaging 0.47
R4731:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4732:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4733:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R5306:Cep104 UTSW 4 154006242 missense probably benign 0.02
R5449:Cep104 UTSW 4 153985305 splice site probably null
R5567:Cep104 UTSW 4 154002277 missense possibly damaging 0.64
R5761:Cep104 UTSW 4 153981224 missense possibly damaging 0.63
R5980:Cep104 UTSW 4 153988473 missense probably benign 0.00
R7003:Cep104 UTSW 4 153993561 missense probably benign 0.00
R7179:Cep104 UTSW 4 153992867 missense probably damaging 0.99
X0026:Cep104 UTSW 4 153986885 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTGGAGCATTAGAACATCAG -3'
(R):5'- GCTGCTAACTTCTCTGACAGTC -3'

Sequencing Primer
(F):5'- GAGCATTAGAACATCAGGGCTCTC -3'
(R):5'- TGTAACGAGATCTGATGCCC -3'
Posted On2019-11-11