Incidental Mutation 'R7654:Cfap65'
ID591037
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R7654 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74933144 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 19 (C19S)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: C19S

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: C19S

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,826,593 V1140M possibly damaging Het
Adamtsl3 A C 7: 82,574,494 E1161A probably benign Het
Adcy5 T C 16: 35,270,947 S587P probably damaging Het
Aebp2 T A 6: 140,653,748 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankhd1 T C 18: 36,594,101 V423A probably damaging Het
Arid1b T A 17: 5,291,085 M888K possibly damaging Het
Asl C A 5: 130,018,390 R122S probably damaging Het
B3gntl1 T A 11: 121,651,613 D109V probably damaging Het
Cat G A 2: 103,460,364 P402S probably damaging Het
Ccdc141 A T 2: 77,042,478 Y787N probably benign Het
Ccdc78 T C 17: 25,790,111 Y405H probably damaging Het
Ces1f T G 8: 93,271,934 K145Q probably benign Het
CN725425 T A 15: 91,239,435 I118N probably benign Het
Ctc1 C T 11: 69,026,215 P312S probably damaging Het
Ctsa C T 2: 164,838,933 T442I probably benign Het
Cyp2b9 A G 7: 26,186,942 T131A possibly damaging Het
D630045J12Rik A G 6: 38,177,701 M1181T probably damaging Het
Dagla C G 19: 10,248,206 G865R probably benign Het
Dst A C 1: 34,228,977 K3153Q probably damaging Het
Dst A T 1: 34,228,978 K3153M probably damaging Het
Dync2h1 A T 9: 7,122,664 H2097Q probably damaging Het
Etnppl A G 3: 130,629,511 I286M probably benign Het
Flvcr1 A T 1: 191,011,605 M418K possibly damaging Het
Fuca1 T C 4: 135,929,921 S215P probably damaging Het
Gabrg1 T C 5: 70,778,161 K222E probably benign Het
Gdpd5 G A 7: 99,424,189 R26H probably damaging Het
Gnptab T A 10: 88,445,819 S1229R possibly damaging Het
Gpt A G 15: 76,698,330 E256G probably benign Het
Hif3a C T 7: 17,049,096 V261I probably damaging Het
Hmcn2 A G 2: 31,346,569 T375A probably benign Het
Hspa4 C A 11: 53,300,124 V15F probably damaging Het
Il18 A G 9: 50,579,401 N112S possibly damaging Het
Inpp4a A G 1: 37,374,098 probably null Het
Knop1 A G 7: 118,845,809 S525P unknown Het
Leo1 A T 9: 75,455,679 Y461F possibly damaging Het
Med1 C T 11: 98,169,363 V247I possibly damaging Het
Mpnd T G 17: 56,010,489 H159Q probably benign Het
Msl1 A G 11: 98,796,111 E94G possibly damaging Het
Mthfd2l A T 5: 90,946,806 I45F probably damaging Het
Neurl1b T A 17: 26,438,697 L203Q probably benign Het
Olfr1024 G T 2: 85,904,319 T245N possibly damaging Het
Otoa T G 7: 121,147,700 L896R probably damaging Het
Pcdhac2 T A 18: 37,145,023 V352E probably damaging Het
Pcsk5 T A 19: 17,456,804 K1400I possibly damaging Het
Pcx T A 19: 4,515,669 probably null Het
Pds5a A G 5: 65,618,981 V90A probably damaging Het
Pgam2 T C 11: 5,803,351 K113R probably null Het
Phkb G T 8: 85,940,887 R266L possibly damaging Het
Phtf2 A G 5: 20,782,461 S346P probably damaging Het
Pkd1l3 G A 8: 109,638,417 A1144T probably damaging Het
Plbd1 T C 6: 136,651,866 Y68C possibly damaging Het
Polk T C 13: 96,496,813 T241A probably benign Het
Ppfibp2 T A 7: 107,738,611 D635E probably damaging Het
Ppip5k1 G A 2: 121,348,559 R229W probably damaging Het
Ptpn20 A G 14: 33,638,324 D386G probably benign Het
Rab22a T C 2: 173,688,175 Y49H probably benign Het
Rab3gap1 A G 1: 127,909,915 D238G probably damaging Het
Rbp3 T C 14: 33,955,840 S582P probably benign Het
Rcbtb2 T C 14: 73,174,501 V410A probably benign Het
Sh3rf2 A G 18: 42,104,108 E232G probably damaging Het
Shroom1 T A 11: 53,466,908 V762E probably benign Het
Speer4f2 A T 5: 17,374,415 M71L Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Tgfb1 A T 7: 25,687,695 probably benign Het
Tnik C T 3: 28,604,185 R540C probably damaging Het
Tti1 A T 2: 158,008,554 I255N probably benign Het
Ttn T C 2: 76,897,146 S5739G unknown Het
Umad1 G A 6: 8,426,995 V57M probably damaging Het
Usp30 T A 5: 114,102,445 I49N probably damaging Het
Usp7 G A 16: 8,702,043 T398I probably benign Het
Vmn2r65 A G 7: 84,941,053 Y552H probably damaging Het
Zfp616 A G 11: 74,083,187 N185S possibly damaging Het
Zfp804b T A 5: 6,769,458 T1202S probably damaging Het
Zfyve28 A T 5: 34,243,195 V53D probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGTATATGGGAAAGTCTGTCCC -3'
(R):5'- GCGCCACCTCATAGCAATAG -3'

Sequencing Primer
(F):5'- CCCAGACGTTCACCCTATTGTACTG -3'
(R):5'- TAGCACTTGTCAAAACAGAGAGC -3'
Posted On2019-11-12