Incidental Mutation 'R7654:Cat'
ID591044
Institutional Source Beutler Lab
Gene Symbol Cat
Ensembl Gene ENSMUSG00000027187
Gene Namecatalase
SynonymsCas1, Cas-1, Cs-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7654 (G1)
Quality Score175.009
Status Not validated
Chromosome2
Chromosomal Location103453849-103485160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103460364 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 402 (P402S)
Ref Sequence ENSEMBL: ENSMUSP00000028610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028610] [ENSMUST00000111168]
Predicted Effect probably damaging
Transcript: ENSMUST00000028610
AA Change: P402S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028610
Gene: ENSMUSG00000027187
AA Change: P402S

DomainStartEndE-ValueType
Catalase 28 413 4.7e-285 SMART
Pfam:Catalase-rel 434 497 5.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111168
SMART Domains Protein: ENSMUSP00000106798
Gene: ENSMUSG00000027187

DomainStartEndE-ValueType
Catalase 28 176 2.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype although subtle abnormalities do occur in mitochondrial respiration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,826,593 V1140M possibly damaging Het
Adamtsl3 A C 7: 82,574,494 E1161A probably benign Het
Adcy5 T C 16: 35,270,947 S587P probably damaging Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankhd1 T C 18: 36,594,101 V423A probably damaging Het
Arid1b T A 17: 5,291,085 M888K possibly damaging Het
Asl C A 5: 130,018,390 R122S probably damaging Het
B3gntl1 T A 11: 121,651,613 D109V probably damaging Het
Ccdc141 A T 2: 77,042,478 Y787N probably benign Het
Ccdc78 T C 17: 25,790,111 Y405H probably damaging Het
Ces1f T G 8: 93,271,934 K145Q probably benign Het
Cfap65 A T 1: 74,933,144 C19S probably benign Het
CN725425 T A 15: 91,239,435 I118N probably benign Het
Ctc1 C T 11: 69,026,215 P312S probably damaging Het
Ctsa C T 2: 164,838,933 T442I probably benign Het
Cyp2b9 A G 7: 26,186,942 T131A possibly damaging Het
D630045J12Rik A G 6: 38,177,701 M1181T probably damaging Het
Dagla C G 19: 10,248,206 G865R probably benign Het
Dst A C 1: 34,228,977 K3153Q probably damaging Het
Dst A T 1: 34,228,978 K3153M probably damaging Het
Dync2h1 A T 9: 7,122,664 H2097Q probably damaging Het
Etnppl A G 3: 130,629,511 I286M probably benign Het
Flvcr1 A T 1: 191,011,605 M418K possibly damaging Het
Fuca1 T C 4: 135,929,921 S215P probably damaging Het
Gabrg1 T C 5: 70,778,161 K222E probably benign Het
Gdpd5 G A 7: 99,424,189 R26H probably damaging Het
Gm21886 GCTCACTGAGGCCTGCAGACAGTAGGTACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGT GCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGT 18: 80,089,798 probably benign Het
Gnptab T A 10: 88,445,819 S1229R possibly damaging Het
Gpt A G 15: 76,698,330 E256G probably benign Het
Hif3a C T 7: 17,049,096 V261I probably damaging Het
Hmcn2 A G 2: 31,346,569 T375A probably benign Het
Hspa4 C A 11: 53,300,124 V15F probably damaging Het
Il18 A G 9: 50,579,401 N112S possibly damaging Het
Knop1 A G 7: 118,845,809 S525P unknown Het
Leo1 A T 9: 75,455,679 Y461F possibly damaging Het
Med1 C T 11: 98,169,363 V247I possibly damaging Het
Mpnd T G 17: 56,010,489 H159Q probably benign Het
Msl1 A G 11: 98,796,111 E94G possibly damaging Het
Mthfd2l A T 5: 90,946,806 I45F probably damaging Het
Neurl1b T A 17: 26,438,697 L203Q probably benign Het
Olfr1024 G T 2: 85,904,319 T245N possibly damaging Het
Otoa T G 7: 121,147,700 L896R probably damaging Het
Pcdhac2 T A 18: 37,145,023 V352E probably damaging Het
Pcsk5 T A 19: 17,456,804 K1400I possibly damaging Het
Pds5a A G 5: 65,618,981 V90A probably damaging Het
Pgam2 T C 11: 5,803,351 K113R probably null Het
Phkb G T 8: 85,940,887 R266L possibly damaging Het
Phtf2 A G 5: 20,782,461 S346P probably damaging Het
Pkd1l3 G A 8: 109,638,417 A1144T probably damaging Het
Plbd1 T C 6: 136,651,866 Y68C possibly damaging Het
Polk T C 13: 96,496,813 T241A probably benign Het
Ppfibp2 T A 7: 107,738,611 D635E probably damaging Het
Ppip5k1 G A 2: 121,348,559 R229W probably damaging Het
Ptpn20 A G 14: 33,638,324 D386G probably benign Het
Rab22a T C 2: 173,688,175 Y49H probably benign Het
Rab3gap1 A G 1: 127,909,915 D238G probably damaging Het
Rbp3 T C 14: 33,955,840 S582P probably benign Het
Rcbtb2 T C 14: 73,174,501 V410A probably benign Het
Sh3rf2 A G 18: 42,104,108 E232G probably damaging Het
Shroom1 T A 11: 53,466,908 V762E probably benign Het
Speer4f2 A T 5: 17,374,415 M71L Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Tnik C T 3: 28,604,185 R540C probably damaging Het
Tti1 A T 2: 158,008,554 I255N probably benign Het
Ttn T C 2: 76,897,146 S5739G unknown Het
Umad1 G A 6: 8,426,995 V57M probably damaging Het
Usp30 T A 5: 114,102,445 I49N probably damaging Het
Usp7 G A 16: 8,702,043 T398I probably benign Het
Vmn2r65 A G 7: 84,941,053 Y552H probably damaging Het
Zfp616 A G 11: 74,083,187 N185S possibly damaging Het
Zfp804b T A 5: 6,769,458 T1202S probably damaging Het
Zfyve28 A T 5: 34,243,195 V53D probably damaging Het
Other mutations in Cat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02989:Cat APN 2 103472973 missense probably damaging 1.00
PIT4696001:Cat UTSW 2 103471812 missense probably damaging 0.99
R1968:Cat UTSW 2 103484989 missense probably benign 0.01
R2103:Cat UTSW 2 103463315 missense probably damaging 1.00
R2655:Cat UTSW 2 103471846 missense probably damaging 1.00
R3037:Cat UTSW 2 103467777 missense probably benign 0.07
R5287:Cat UTSW 2 103474360 missense probably damaging 1.00
R5527:Cat UTSW 2 103472973 missense probably damaging 1.00
R5694:Cat UTSW 2 103472994 missense probably damaging 1.00
R6089:Cat UTSW 2 103472951 missense probably null 0.48
R6177:Cat UTSW 2 103473075 missense probably damaging 1.00
R6281:Cat UTSW 2 103471769 missense probably damaging 1.00
R6294:Cat UTSW 2 103460295 missense probably benign
R7058:Cat UTSW 2 103474353 missense probably benign 0.31
R7274:Cat UTSW 2 103476890 missense probably benign 0.07
R7347:Cat UTSW 2 103463298 missense probably benign
R7762:Cat UTSW 2 103456858 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTCGTTAATGAGGTCTGACAAG -3'
(R):5'- TTTACTCAGGCAGCCCACAC -3'

Sequencing Primer
(F):5'- CGTTAATGAGGTCTGACAAGAAAAAC -3'
(R):5'- CGAGCCTGTAGTTAGACCTGAG -3'
Posted On2019-11-12