Incidental Mutation 'R7654:Phtf2'
ID591055
Institutional Source Beutler Lab
Gene Symbol Phtf2
Ensembl Gene ENSMUSG00000039987
Gene Nameputative homeodomain transcription factor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7654 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location20758663-20882124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20782461 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 346 (S346P)
Ref Sequence ENSEMBL: ENSMUSP00000114087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118174]
Predicted Effect probably damaging
Transcript: ENSMUST00000118174
AA Change: S346P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114087
Gene: ENSMUSG00000039987
AA Change: S346P

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 154 1.3e-76 PFAM
low complexity region 340 359 N/A INTRINSIC
transmembrane domain 457 479 N/A INTRINSIC
transmembrane domain 511 533 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
transmembrane domain 628 647 N/A INTRINSIC
transmembrane domain 715 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124431
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,826,593 V1140M possibly damaging Het
Adamtsl3 A C 7: 82,574,494 E1161A probably benign Het
Adcy5 T C 16: 35,270,947 S587P probably damaging Het
Aebp2 T A 6: 140,653,748 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankhd1 T C 18: 36,594,101 V423A probably damaging Het
Arid1b T A 17: 5,291,085 M888K possibly damaging Het
Asl C A 5: 130,018,390 R122S probably damaging Het
B3gntl1 T A 11: 121,651,613 D109V probably damaging Het
Cat G A 2: 103,460,364 P402S probably damaging Het
Ccdc141 A T 2: 77,042,478 Y787N probably benign Het
Ccdc78 T C 17: 25,790,111 Y405H probably damaging Het
Ces1f T G 8: 93,271,934 K145Q probably benign Het
Cfap65 A T 1: 74,933,144 C19S probably benign Het
CN725425 T A 15: 91,239,435 I118N probably benign Het
Ctc1 C T 11: 69,026,215 P312S probably damaging Het
Ctsa C T 2: 164,838,933 T442I probably benign Het
Cyp2b9 A G 7: 26,186,942 T131A possibly damaging Het
D630045J12Rik A G 6: 38,177,701 M1181T probably damaging Het
Dagla C G 19: 10,248,206 G865R probably benign Het
Dst A C 1: 34,228,977 K3153Q probably damaging Het
Dst A T 1: 34,228,978 K3153M probably damaging Het
Dync2h1 A T 9: 7,122,664 H2097Q probably damaging Het
Etnppl A G 3: 130,629,511 I286M probably benign Het
Flvcr1 A T 1: 191,011,605 M418K possibly damaging Het
Fuca1 T C 4: 135,929,921 S215P probably damaging Het
Gabrg1 T C 5: 70,778,161 K222E probably benign Het
Gdpd5 G A 7: 99,424,189 R26H probably damaging Het
Gnptab T A 10: 88,445,819 S1229R possibly damaging Het
Gpt A G 15: 76,698,330 E256G probably benign Het
Hif3a C T 7: 17,049,096 V261I probably damaging Het
Hmcn2 A G 2: 31,346,569 T375A probably benign Het
Hspa4 C A 11: 53,300,124 V15F probably damaging Het
Il18 A G 9: 50,579,401 N112S possibly damaging Het
Inpp4a A G 1: 37,374,098 probably null Het
Knop1 A G 7: 118,845,809 S525P unknown Het
Leo1 A T 9: 75,455,679 Y461F possibly damaging Het
Med1 C T 11: 98,169,363 V247I possibly damaging Het
Mpnd T G 17: 56,010,489 H159Q probably benign Het
Msl1 A G 11: 98,796,111 E94G possibly damaging Het
Mthfd2l A T 5: 90,946,806 I45F probably damaging Het
Neurl1b T A 17: 26,438,697 L203Q probably benign Het
Olfr1024 G T 2: 85,904,319 T245N possibly damaging Het
Otoa T G 7: 121,147,700 L896R probably damaging Het
Pcdhac2 T A 18: 37,145,023 V352E probably damaging Het
Pcsk5 T A 19: 17,456,804 K1400I possibly damaging Het
Pcx T A 19: 4,515,669 probably null Het
Pds5a A G 5: 65,618,981 V90A probably damaging Het
Pgam2 T C 11: 5,803,351 K113R probably null Het
Phkb G T 8: 85,940,887 R266L possibly damaging Het
Pkd1l3 G A 8: 109,638,417 A1144T probably damaging Het
Plbd1 T C 6: 136,651,866 Y68C possibly damaging Het
Polk T C 13: 96,496,813 T241A probably benign Het
Ppfibp2 T A 7: 107,738,611 D635E probably damaging Het
Ppip5k1 G A 2: 121,348,559 R229W probably damaging Het
Ptpn20 A G 14: 33,638,324 D386G probably benign Het
Rab22a T C 2: 173,688,175 Y49H probably benign Het
Rab3gap1 A G 1: 127,909,915 D238G probably damaging Het
Rbp3 T C 14: 33,955,840 S582P probably benign Het
Rcbtb2 T C 14: 73,174,501 V410A probably benign Het
Sh3rf2 A G 18: 42,104,108 E232G probably damaging Het
Shroom1 T A 11: 53,466,908 V762E probably benign Het
Speer4f2 A T 5: 17,374,415 M71L Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Tgfb1 A T 7: 25,687,695 probably benign Het
Tnik C T 3: 28,604,185 R540C probably damaging Het
Tti1 A T 2: 158,008,554 I255N probably benign Het
Ttn T C 2: 76,897,146 S5739G unknown Het
Umad1 G A 6: 8,426,995 V57M probably damaging Het
Usp30 T A 5: 114,102,445 I49N probably damaging Het
Usp7 G A 16: 8,702,043 T398I probably benign Het
Vmn2r65 A G 7: 84,941,053 Y552H probably damaging Het
Zfp616 A G 11: 74,083,187 N185S possibly damaging Het
Zfp804b T A 5: 6,769,458 T1202S probably damaging Het
Zfyve28 A T 5: 34,243,195 V53D probably damaging Het
Other mutations in Phtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Phtf2 APN 5 20782267 unclassified probably benign
IGL01789:Phtf2 APN 5 20794374 missense probably benign 0.00
IGL01816:Phtf2 APN 5 20803276 missense probably damaging 1.00
IGL02266:Phtf2 APN 5 20805799 missense probably damaging 1.00
IGL02295:Phtf2 APN 5 20807430 missense probably damaging 1.00
IGL03086:Phtf2 APN 5 20764275 missense probably damaging 0.99
IGL03179:Phtf2 APN 5 20782399 missense probably damaging 1.00
IGL03192:Phtf2 APN 5 20761719 missense probably damaging 0.99
IGL03256:Phtf2 APN 5 20803252 missense probably damaging 0.98
PIT4480001:Phtf2 UTSW 5 20813244 missense probably damaging 1.00
PIT4802001:Phtf2 UTSW 5 20801906 missense probably damaging 0.96
R0589:Phtf2 UTSW 5 20813251 nonsense probably null
R1732:Phtf2 UTSW 5 20789627 critical splice donor site probably null
R3151:Phtf2 UTSW 5 20765804 missense probably damaging 1.00
R3791:Phtf2 UTSW 5 20782298 missense probably damaging 1.00
R3843:Phtf2 UTSW 5 20774022 missense probably damaging 1.00
R4080:Phtf2 UTSW 5 20813296 missense probably damaging 1.00
R4569:Phtf2 UTSW 5 20789595 intron probably benign
R4627:Phtf2 UTSW 5 20773740 missense probably damaging 1.00
R4901:Phtf2 UTSW 5 20805724 missense possibly damaging 0.73
R5131:Phtf2 UTSW 5 20774052 missense probably damaging 1.00
R5276:Phtf2 UTSW 5 20772197 missense probably benign 0.19
R5871:Phtf2 UTSW 5 20794401 missense probably benign 0.16
R5941:Phtf2 UTSW 5 20774073 missense probably damaging 0.98
R5964:Phtf2 UTSW 5 20775934 missense probably damaging 1.00
R6318:Phtf2 UTSW 5 20801941 missense probably damaging 1.00
R6621:Phtf2 UTSW 5 20812956 intron probably benign
R6684:Phtf2 UTSW 5 20812939 critical splice donor site probably benign
R7003:Phtf2 UTSW 5 20794401 missense probably benign 0.16
R7253:Phtf2 UTSW 5 20765858 missense possibly damaging 0.73
R7566:Phtf2 UTSW 5 20765801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGATGAAAAGGGTCGTCTC -3'
(R):5'- TAAAACCAGAGGGCATCCTTTTG -3'

Sequencing Primer
(F):5'- GATGAAAAGGGTCGTCTCTATATTC -3'
(R):5'- ACCAGAGGGCATCCTTTTGTTAGTC -3'
Posted On2019-11-12