Incidental Mutation 'R7654:Pds5a'
ID591057
Institutional Source Beutler Lab
Gene Symbol Pds5a
Ensembl Gene ENSMUSG00000029202
Gene NamePDS5 cohesin associated factor A
Synonyms9030416H16Rik, E230024D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7654 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location65605721-65698273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65618981 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 90 (V90A)
Ref Sequence ENSEMBL: ENSMUSP00000144463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031104] [ENSMUST00000201948] [ENSMUST00000202648]
Predicted Effect probably benign
Transcript: ENSMUST00000031104
AA Change: V1206A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031104
Gene: ENSMUSG00000029202
AA Change: V1206A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201948
AA Change: V1206A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144171
Gene: ENSMUSG00000029202
AA Change: V1206A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202648
AA Change: V90A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144463
Gene: ENSMUSG00000029202
AA Change: V90A

DomainStartEndE-ValueType
low complexity region 58 74 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with respiratory distress, abnormal heart development, abnormal skeletal development, kidney agenesis, and delayed enteric nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,826,593 V1140M possibly damaging Het
Adamtsl3 A C 7: 82,574,494 E1161A probably benign Het
Adcy5 T C 16: 35,270,947 S587P probably damaging Het
Aebp2 T A 6: 140,653,748 probably null Het
Alb G C 5: 90,467,355 R242P probably damaging Het
Ankhd1 T C 18: 36,594,101 V423A probably damaging Het
Arid1b T A 17: 5,291,085 M888K possibly damaging Het
Asl C A 5: 130,018,390 R122S probably damaging Het
B3gntl1 T A 11: 121,651,613 D109V probably damaging Het
Cat G A 2: 103,460,364 P402S probably damaging Het
Ccdc141 A T 2: 77,042,478 Y787N probably benign Het
Ccdc78 T C 17: 25,790,111 Y405H probably damaging Het
Ces1f T G 8: 93,271,934 K145Q probably benign Het
Cfap65 A T 1: 74,933,144 C19S probably benign Het
CN725425 T A 15: 91,239,435 I118N probably benign Het
Ctc1 C T 11: 69,026,215 P312S probably damaging Het
Ctsa C T 2: 164,838,933 T442I probably benign Het
Cyp2b9 A G 7: 26,186,942 T131A possibly damaging Het
D630045J12Rik A G 6: 38,177,701 M1181T probably damaging Het
Dagla C G 19: 10,248,206 G865R probably benign Het
Dst A C 1: 34,228,977 K3153Q probably damaging Het
Dst A T 1: 34,228,978 K3153M probably damaging Het
Dync2h1 A T 9: 7,122,664 H2097Q probably damaging Het
Etnppl A G 3: 130,629,511 I286M probably benign Het
Flvcr1 A T 1: 191,011,605 M418K possibly damaging Het
Fuca1 T C 4: 135,929,921 S215P probably damaging Het
Gabrg1 T C 5: 70,778,161 K222E probably benign Het
Gdpd5 G A 7: 99,424,189 R26H probably damaging Het
Gnptab T A 10: 88,445,819 S1229R possibly damaging Het
Gpt A G 15: 76,698,330 E256G probably benign Het
Hif3a C T 7: 17,049,096 V261I probably damaging Het
Hmcn2 A G 2: 31,346,569 T375A probably benign Het
Hspa4 C A 11: 53,300,124 V15F probably damaging Het
Il18 A G 9: 50,579,401 N112S possibly damaging Het
Inpp4a A G 1: 37,374,098 probably null Het
Knop1 A G 7: 118,845,809 S525P unknown Het
Leo1 A T 9: 75,455,679 Y461F possibly damaging Het
Med1 C T 11: 98,169,363 V247I possibly damaging Het
Mpnd T G 17: 56,010,489 H159Q probably benign Het
Msl1 A G 11: 98,796,111 E94G possibly damaging Het
Mthfd2l A T 5: 90,946,806 I45F probably damaging Het
Neurl1b T A 17: 26,438,697 L203Q probably benign Het
Olfr1024 G T 2: 85,904,319 T245N possibly damaging Het
Otoa T G 7: 121,147,700 L896R probably damaging Het
Pcdhac2 T A 18: 37,145,023 V352E probably damaging Het
Pcsk5 T A 19: 17,456,804 K1400I possibly damaging Het
Pcx T A 19: 4,515,669 probably null Het
Pgam2 T C 11: 5,803,351 K113R probably null Het
Phkb G T 8: 85,940,887 R266L possibly damaging Het
Phtf2 A G 5: 20,782,461 S346P probably damaging Het
Pkd1l3 G A 8: 109,638,417 A1144T probably damaging Het
Plbd1 T C 6: 136,651,866 Y68C possibly damaging Het
Polk T C 13: 96,496,813 T241A probably benign Het
Ppfibp2 T A 7: 107,738,611 D635E probably damaging Het
Ppip5k1 G A 2: 121,348,559 R229W probably damaging Het
Ptpn20 A G 14: 33,638,324 D386G probably benign Het
Rab22a T C 2: 173,688,175 Y49H probably benign Het
Rab3gap1 A G 1: 127,909,915 D238G probably damaging Het
Rbp3 T C 14: 33,955,840 S582P probably benign Het
Rcbtb2 T C 14: 73,174,501 V410A probably benign Het
Sh3rf2 A G 18: 42,104,108 E232G probably damaging Het
Shroom1 T A 11: 53,466,908 V762E probably benign Het
Speer4f2 A T 5: 17,374,415 M71L Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Tgfb1 A T 7: 25,687,695 probably benign Het
Tnik C T 3: 28,604,185 R540C probably damaging Het
Tti1 A T 2: 158,008,554 I255N probably benign Het
Ttn T C 2: 76,897,146 S5739G unknown Het
Umad1 G A 6: 8,426,995 V57M probably damaging Het
Usp30 T A 5: 114,102,445 I49N probably damaging Het
Usp7 G A 16: 8,702,043 T398I probably benign Het
Vmn2r65 A G 7: 84,941,053 Y552H probably damaging Het
Zfp616 A G 11: 74,083,187 N185S possibly damaging Het
Zfp804b T A 5: 6,769,458 T1202S probably damaging Het
Zfyve28 A T 5: 34,243,195 V53D probably damaging Het
Other mutations in Pds5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Pds5a APN 5 65656344 missense probably damaging 1.00
IGL00979:Pds5a APN 5 65631723 missense probably benign 0.22
IGL01314:Pds5a APN 5 65615294 missense probably benign
IGL02449:Pds5a APN 5 65619010 missense probably damaging 1.00
IGL02539:Pds5a APN 5 65666119 missense probably damaging 1.00
IGL03395:Pds5a APN 5 65652449 missense possibly damaging 0.61
R0569:Pds5a UTSW 5 65656401 missense probably damaging 1.00
R0704:Pds5a UTSW 5 65620585 missense probably damaging 1.00
R1170:Pds5a UTSW 5 65635302 splice site probably benign
R1181:Pds5a UTSW 5 65627202 splice site probably null
R1193:Pds5a UTSW 5 65637802 missense probably damaging 1.00
R1537:Pds5a UTSW 5 65647121 missense probably benign 0.09
R1853:Pds5a UTSW 5 65624029 missense possibly damaging 0.56
R2016:Pds5a UTSW 5 65648007 critical splice acceptor site probably null
R2154:Pds5a UTSW 5 65650498 missense probably damaging 1.00
R2209:Pds5a UTSW 5 65628014 nonsense probably null
R2234:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2235:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2332:Pds5a UTSW 5 65627079 splice site probably null
R3114:Pds5a UTSW 5 65618985 missense probably damaging 1.00
R3417:Pds5a UTSW 5 65637892 missense probably damaging 0.99
R3820:Pds5a UTSW 5 65654076 missense possibly damaging 0.94
R4152:Pds5a UTSW 5 65666171 nonsense probably null
R4159:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4160:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4161:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4230:Pds5a UTSW 5 65629986 missense possibly damaging 0.85
R4491:Pds5a UTSW 5 65635437 missense probably benign
R4647:Pds5a UTSW 5 65656318 missense probably damaging 1.00
R4816:Pds5a UTSW 5 65651289 missense probably damaging 1.00
R4867:Pds5a UTSW 5 65644120 missense probably damaging 1.00
R5001:Pds5a UTSW 5 65696785 missense probably damaging 0.99
R5013:Pds5a UTSW 5 65635337 missense probably benign 0.05
R5054:Pds5a UTSW 5 65637814 missense probably damaging 1.00
R5068:Pds5a UTSW 5 65615272 missense probably damaging 0.99
R5178:Pds5a UTSW 5 65663875 missense probably damaging 1.00
R5269:Pds5a UTSW 5 65663928 missense probably damaging 1.00
R5396:Pds5a UTSW 5 65638577 missense probably benign 0.09
R5704:Pds5a UTSW 5 65627079 splice site probably null
R5940:Pds5a UTSW 5 65643985 intron probably benign
R6306:Pds5a UTSW 5 65656296 missense probably damaging 1.00
R6322:Pds5a UTSW 5 65696834 missense probably benign 0.00
R6467:Pds5a UTSW 5 65652439 missense probably damaging 1.00
R6476:Pds5a UTSW 5 65634287 missense possibly damaging 0.94
R6513:Pds5a UTSW 5 65615601 missense probably benign 0.18
R7304:Pds5a UTSW 5 65619734 missense probably damaging 1.00
R7312:Pds5a UTSW 5 65666227 missense possibly damaging 0.81
R7438:Pds5a UTSW 5 65652535 critical splice acceptor site probably null
R7637:Pds5a UTSW 5 65638604 missense probably benign 0.12
R7707:Pds5a UTSW 5 65610133 missense unknown
R7715:Pds5a UTSW 5 65638561 missense possibly damaging 0.96
R7748:Pds5a UTSW 5 65619666 missense possibly damaging 0.93
R7910:Pds5a UTSW 5 65638582 missense possibly damaging 0.85
R7991:Pds5a UTSW 5 65638582 missense possibly damaging 0.85
R8014:Pds5a UTSW 5 65627739 missense possibly damaging 0.56
R8023:Pds5a UTSW 5 65637898 missense probably damaging 1.00
R8070:Pds5a UTSW 5 65652398 missense possibly damaging 0.92
Z1088:Pds5a UTSW 5 65618986 missense probably damaging 1.00
Z1176:Pds5a UTSW 5 65659727 missense possibly damaging 0.75
Z1177:Pds5a UTSW 5 65651212 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGCCTCAATAACGTGGAAGGAG -3'
(R):5'- GGTCTCTCAGGCAAGTGGATATATAG -3'

Sequencing Primer
(F):5'- TAACGTGGAAGGAGAGAAATGACTC -3'
(R):5'- GTCTGTCTTTCTAGTAGGGA -3'
Posted On2019-11-12