Incidental Mutation 'R7654:Cyp2b9'
ID 591067
Institutional Source Beutler Lab
Gene Symbol Cyp2b9
Ensembl Gene ENSMUSG00000040660
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms phenobarbitol inducible, type a, Cyp2b
MMRRC Submission 045702-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R7654 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 25872836-25910086 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25886367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 131 (T131A)
Ref Sequence ENSEMBL: ENSMUSP00000080846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082214]
AlphaFold P12790
Predicted Effect possibly damaging
Transcript: ENSMUST00000082214
AA Change: T131A

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080846
Gene: ENSMUSG00000040660
AA Change: T131A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 1.7e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,815,032 (GRCm39) V1140M possibly damaging Het
Adamtsl3 A C 7: 82,223,702 (GRCm39) E1161A probably benign Het
Adcy5 T C 16: 35,091,317 (GRCm39) S587P probably damaging Het
Aebp2 T A 6: 140,599,474 (GRCm39) probably null Het
Alb G C 5: 90,615,214 (GRCm39) R242P probably damaging Het
Ankhd1 T C 18: 36,727,154 (GRCm39) V423A probably damaging Het
Arid1b T A 17: 5,341,360 (GRCm39) M888K possibly damaging Het
Asl C A 5: 130,047,231 (GRCm39) R122S probably damaging Het
B3gntl1 T A 11: 121,542,439 (GRCm39) D109V probably damaging Het
Cat G A 2: 103,290,709 (GRCm39) P402S probably damaging Het
Ccdc141 A T 2: 76,872,822 (GRCm39) Y787N probably benign Het
Ccdc78 T C 17: 26,009,085 (GRCm39) Y405H probably damaging Het
Ces1f T G 8: 93,998,562 (GRCm39) K145Q probably benign Het
Cfap65 A T 1: 74,972,303 (GRCm39) C19S probably benign Het
CN725425 T A 15: 91,123,638 (GRCm39) I118N probably benign Het
Ctc1 C T 11: 68,917,041 (GRCm39) P312S probably damaging Het
Ctsa C T 2: 164,680,853 (GRCm39) T442I probably benign Het
D630045J12Rik A G 6: 38,154,636 (GRCm39) M1181T probably damaging Het
Dagla C G 19: 10,225,570 (GRCm39) G865R probably benign Het
Dst A C 1: 34,268,058 (GRCm39) K3153Q probably damaging Het
Dst A T 1: 34,268,059 (GRCm39) K3153M probably damaging Het
Dync2h1 A T 9: 7,122,664 (GRCm39) H2097Q probably damaging Het
Etnppl A G 3: 130,423,160 (GRCm39) I286M probably benign Het
Flvcr1 A T 1: 190,743,802 (GRCm39) M418K possibly damaging Het
Fuca1 T C 4: 135,657,232 (GRCm39) S215P probably damaging Het
Gabrg1 T C 5: 70,935,504 (GRCm39) K222E probably benign Het
Gdpd5 G A 7: 99,073,396 (GRCm39) R26H probably damaging Het
Gnptab T A 10: 88,281,681 (GRCm39) S1229R possibly damaging Het
Gpt A G 15: 76,582,530 (GRCm39) E256G probably benign Het
Hif3a C T 7: 16,783,021 (GRCm39) V261I probably damaging Het
Hmcn2 A G 2: 31,236,581 (GRCm39) T375A probably benign Het
Hspa4 C A 11: 53,190,951 (GRCm39) V15F probably damaging Het
Il18 A G 9: 50,490,701 (GRCm39) N112S possibly damaging Het
Inpp4a A G 1: 37,413,179 (GRCm39) probably null Het
Knop1 A G 7: 118,445,032 (GRCm39) S525P unknown Het
Leo1 A T 9: 75,362,961 (GRCm39) Y461F possibly damaging Het
Med1 C T 11: 98,060,189 (GRCm39) V247I possibly damaging Het
Mpnd T G 17: 56,317,489 (GRCm39) H159Q probably benign Het
Msl1 A G 11: 98,686,937 (GRCm39) E94G possibly damaging Het
Mthfd2l A T 5: 91,094,665 (GRCm39) I45F probably damaging Het
Neurl1b T A 17: 26,657,671 (GRCm39) L203Q probably benign Het
Or5m12 G T 2: 85,734,663 (GRCm39) T245N possibly damaging Het
Otoa T G 7: 120,746,923 (GRCm39) L896R probably damaging Het
Pcdhac2 T A 18: 37,278,076 (GRCm39) V352E probably damaging Het
Pcsk5 T A 19: 17,434,168 (GRCm39) K1400I possibly damaging Het
Pcx T A 19: 4,565,697 (GRCm39) probably null Het
Pds5a A G 5: 65,776,324 (GRCm39) V90A probably damaging Het
Pgam2 T C 11: 5,753,351 (GRCm39) K113R probably null Het
Phkb G T 8: 86,667,516 (GRCm39) R266L possibly damaging Het
Phtf2 A G 5: 20,987,459 (GRCm39) S346P probably damaging Het
Pkd1l3 G A 8: 110,365,049 (GRCm39) A1144T probably damaging Het
Plbd1 T C 6: 136,628,864 (GRCm39) Y68C possibly damaging Het
Polk T C 13: 96,633,321 (GRCm39) T241A probably benign Het
Ppfibp2 T A 7: 107,337,818 (GRCm39) D635E probably damaging Het
Ppip5k1 G A 2: 121,179,040 (GRCm39) R229W probably damaging Het
Ptpn20 A G 14: 33,360,281 (GRCm39) D386G probably benign Het
Rab22a T C 2: 173,529,968 (GRCm39) Y49H probably benign Het
Rab3gap1 A G 1: 127,837,652 (GRCm39) D238G probably damaging Het
Rbp3 T C 14: 33,677,797 (GRCm39) S582P probably benign Het
Rcbtb2 T C 14: 73,411,941 (GRCm39) V410A probably benign Het
Sh3rf2 A G 18: 42,237,173 (GRCm39) E232G probably damaging Het
Shroom1 T A 11: 53,357,735 (GRCm39) V762E probably benign Het
Speer4f2 A T 5: 17,579,413 (GRCm39) M71L Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Tgfb1 A T 7: 25,387,120 (GRCm39) probably benign Het
Tnik C T 3: 28,658,334 (GRCm39) R540C probably damaging Het
Tti1 A T 2: 157,850,474 (GRCm39) I255N probably benign Het
Ttn T C 2: 76,727,490 (GRCm39) S5739G unknown Het
Umad1 G A 6: 8,426,995 (GRCm39) V57M probably damaging Het
Usp30 T A 5: 114,240,506 (GRCm39) I49N probably damaging Het
Usp7 G A 16: 8,519,907 (GRCm39) T398I probably benign Het
Vmn2r65 A G 7: 84,590,261 (GRCm39) Y552H probably damaging Het
Zfp616 A G 11: 73,974,013 (GRCm39) N185S possibly damaging Het
Zfp804b T A 5: 6,819,458 (GRCm39) T1202S probably damaging Het
Zfyve28 A T 5: 34,400,539 (GRCm39) V53D probably damaging Het
Other mutations in Cyp2b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cyp2b9 APN 7 25,897,930 (GRCm39) missense probably damaging 0.99
IGL01133:Cyp2b9 APN 7 25,909,660 (GRCm39) missense probably damaging 1.00
IGL01331:Cyp2b9 APN 7 25,887,140 (GRCm39) missense probably damaging 0.99
IGL02281:Cyp2b9 APN 7 25,900,529 (GRCm39) missense probably damaging 0.99
IGL02502:Cyp2b9 APN 7 25,887,239 (GRCm39) critical splice donor site probably null
IGL02713:Cyp2b9 APN 7 25,872,945 (GRCm39) missense probably benign 0.12
IGL03032:Cyp2b9 APN 7 25,898,025 (GRCm39) splice site probably benign
IGL03307:Cyp2b9 APN 7 25,898,476 (GRCm39) missense probably benign 0.00
R0010:Cyp2b9 UTSW 7 25,886,178 (GRCm39) splice site probably benign
R0025:Cyp2b9 UTSW 7 25,900,238 (GRCm39) missense probably benign 0.09
R0040:Cyp2b9 UTSW 7 25,872,899 (GRCm39) missense possibly damaging 0.68
R0184:Cyp2b9 UTSW 7 25,886,432 (GRCm39) nonsense probably null
R0370:Cyp2b9 UTSW 7 25,909,531 (GRCm39) missense probably damaging 1.00
R1595:Cyp2b9 UTSW 7 25,900,332 (GRCm39) missense possibly damaging 0.72
R1751:Cyp2b9 UTSW 7 25,886,100 (GRCm39) missense probably benign 0.05
R1835:Cyp2b9 UTSW 7 25,900,208 (GRCm39) missense probably benign
R1879:Cyp2b9 UTSW 7 25,897,994 (GRCm39) missense probably damaging 0.99
R2256:Cyp2b9 UTSW 7 25,873,030 (GRCm39) critical splice donor site probably null
R2257:Cyp2b9 UTSW 7 25,873,030 (GRCm39) critical splice donor site probably null
R2418:Cyp2b9 UTSW 7 25,886,132 (GRCm39) missense probably benign 0.00
R3420:Cyp2b9 UTSW 7 25,909,528 (GRCm39) missense probably damaging 1.00
R4088:Cyp2b9 UTSW 7 25,872,881 (GRCm39) missense probably damaging 0.99
R4412:Cyp2b9 UTSW 7 25,897,868 (GRCm39) missense probably damaging 1.00
R4495:Cyp2b9 UTSW 7 25,900,180 (GRCm39) missense probably benign 0.00
R4615:Cyp2b9 UTSW 7 25,900,550 (GRCm39) missense probably damaging 1.00
R5375:Cyp2b9 UTSW 7 25,887,167 (GRCm39) missense probably damaging 1.00
R5426:Cyp2b9 UTSW 7 25,887,080 (GRCm39) missense probably benign
R5862:Cyp2b9 UTSW 7 25,887,232 (GRCm39) missense probably benign 0.01
R6237:Cyp2b9 UTSW 7 25,872,999 (GRCm39) missense probably benign 0.02
R6445:Cyp2b9 UTSW 7 25,886,412 (GRCm39) missense probably benign 0.13
R6992:Cyp2b9 UTSW 7 25,900,564 (GRCm39) missense probably benign 0.00
R7515:Cyp2b9 UTSW 7 25,898,596 (GRCm39) missense probably damaging 1.00
R7816:Cyp2b9 UTSW 7 25,900,517 (GRCm39) missense probably benign 0.01
R7850:Cyp2b9 UTSW 7 25,886,111 (GRCm39) nonsense probably null
R8734:Cyp2b9 UTSW 7 25,898,035 (GRCm39) intron probably benign
R8790:Cyp2b9 UTSW 7 25,898,167 (GRCm39) intron probably benign
R8839:Cyp2b9 UTSW 7 25,900,185 (GRCm39) missense probably damaging 0.96
R9209:Cyp2b9 UTSW 7 25,873,004 (GRCm39) missense possibly damaging 0.52
R9723:Cyp2b9 UTSW 7 25,909,596 (GRCm39) nonsense probably null
R9787:Cyp2b9 UTSW 7 25,900,259 (GRCm39) missense probably benign 0.04
Z1177:Cyp2b9 UTSW 7 25,900,588 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGTAGAGTGGACAATGTGACCC -3'
(R):5'- GGTGTTCCAGAAGCCATCAG -3'

Sequencing Primer
(F):5'- TGTGACCCAGGAAAGTGAGCTTG -3'
(R):5'- GCTGCCTTTGTACTCCAGATAGAG -3'
Posted On 2019-11-12