Incidental Mutation 'R7655:Slc26a9'
ID591110
Institutional Source Beutler Lab
Gene Symbol Slc26a9
Ensembl Gene ENSMUSG00000042268
Gene Namesolute carrier family 26, member 9
Synonymsanion transporter/exchanger-9, E030002L01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131744022-131771504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131763244 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 587 (F587I)
Ref Sequence ENSEMBL: ENSMUSP00000036916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000186122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049027
AA Change: F587I

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268
AA Change: F587I

DomainStartEndE-ValueType
Pfam:Sulfate_transp 71 469 7.4e-99 PFAM
transmembrane domain 473 495 N/A INTRINSIC
Pfam:STAS 520 733 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186122
SMART Domains Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_transp 150 428 9.6e-58 PFAM
low complexity region 453 462 N/A INTRINSIC
Meta Mutation Damage Score 0.0912 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Slc26a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc26a9 APN 1 131757528 missense probably damaging 0.97
IGL01131:Slc26a9 APN 1 131755542 splice site probably null
IGL01544:Slc26a9 APN 1 131759495 critical splice donor site probably null
IGL01845:Slc26a9 APN 1 131757518 missense probably damaging 0.99
IGL02125:Slc26a9 APN 1 131759437 missense probably damaging 1.00
IGL02151:Slc26a9 APN 1 131764043 missense probably damaging 1.00
IGL02267:Slc26a9 APN 1 131752845 missense probably damaging 1.00
IGL02469:Slc26a9 APN 1 131762936 missense probably damaging 0.96
IGL03137:Slc26a9 APN 1 131763877 missense probably benign 0.01
IGL03324:Slc26a9 APN 1 131764010 missense probably damaging 1.00
R0588:Slc26a9 UTSW 1 131754011 splice site probably benign
R0611:Slc26a9 UTSW 1 131762761 missense probably damaging 1.00
R0639:Slc26a9 UTSW 1 131763804 missense probably damaging 0.97
R0654:Slc26a9 UTSW 1 131765030 missense probably benign 0.00
R0926:Slc26a9 UTSW 1 131753216 missense probably benign 0.40
R1109:Slc26a9 UTSW 1 131758798 missense probably benign 0.05
R1521:Slc26a9 UTSW 1 131750677 missense probably damaging 1.00
R1728:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1728:Slc26a9 UTSW 1 131766012 missense probably benign
R1729:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1729:Slc26a9 UTSW 1 131766012 missense probably benign
R1730:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1739:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131766012 missense probably benign
R1783:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1783:Slc26a9 UTSW 1 131766012 missense probably benign
R1784:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1784:Slc26a9 UTSW 1 131766012 missense probably benign
R1785:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1785:Slc26a9 UTSW 1 131766012 missense probably benign
R1992:Slc26a9 UTSW 1 131762794 missense probably damaging 1.00
R2198:Slc26a9 UTSW 1 131763263 splice site probably benign
R3008:Slc26a9 UTSW 1 131765914 missense probably damaging 1.00
R3409:Slc26a9 UTSW 1 131763944 missense probably benign
R3879:Slc26a9 UTSW 1 131769231 missense probably benign 0.39
R4064:Slc26a9 UTSW 1 131763187 missense probably benign 0.01
R4088:Slc26a9 UTSW 1 131767849 missense possibly damaging 0.49
R4657:Slc26a9 UTSW 1 131753138 missense probably damaging 1.00
R5005:Slc26a9 UTSW 1 131765887 missense probably damaging 0.99
R6255:Slc26a9 UTSW 1 131763909 missense probably benign 0.00
R6418:Slc26a9 UTSW 1 131758490 missense probably benign 0.06
R6442:Slc26a9 UTSW 1 131758817 missense possibly damaging 0.58
R6674:Slc26a9 UTSW 1 131765018 missense probably benign 0.01
R6719:Slc26a9 UTSW 1 131761785 missense probably benign 0.13
R7202:Slc26a9 UTSW 1 131762788 missense possibly damaging 0.77
R7214:Slc26a9 UTSW 1 131759473 missense probably damaging 0.99
R7238:Slc26a9 UTSW 1 131758818 nonsense probably null
R7389:Slc26a9 UTSW 1 131769248 makesense probably null
R7439:Slc26a9 UTSW 1 131762818 missense probably damaging 1.00
R7441:Slc26a9 UTSW 1 131762818 missense probably damaging 1.00
R7470:Slc26a9 UTSW 1 131764043 missense probably benign 0.33
R7515:Slc26a9 UTSW 1 131753973 missense probably damaging 0.99
R7652:Slc26a9 UTSW 1 131763896 missense probably benign 0.06
R7656:Slc26a9 UTSW 1 131763244 missense possibly damaging 0.88
R8278:Slc26a9 UTSW 1 131761776 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CATCCTTGCTGACCAGAAGG -3'
(R):5'- CATTGAAGATGGGGTGCACTG -3'

Sequencing Primer
(F):5'- GGGCTGAAAAGAGAGTGACC -3'
(R):5'- TGGTACCCAGGAGCTGACAG -3'
Posted On2019-11-12