Incidental Mutation 'R7655:Cd244'
ID591111
Institutional Source Beutler Lab
Gene Symbol Cd244
Ensembl Gene ENSMUSG00000004709
Gene NameCD244 natural killer cell receptor 2B4
Synonyms2B4, C9.1, F730046O15Rik, Nmrk
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171559193-171609746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 171577255 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 225 (L225Q)
Ref Sequence ENSEMBL: ENSMUSP00000004829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004829] [ENSMUST00000194797]
PDB Structure
NMR structure of the D1 domain of the Natural Killer Cell Receptor, 2B4 [SOLUTION NMR]
Structure of NK cell receptor 2B4 (CD244) bound to its ligand CD48 [X-RAY DIFFRACTION]
Structure of NK cell receptor 2B4 (CD244) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000004829
AA Change: L225Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004829
Gene: ENSMUSG00000004709
AA Change: L225Q

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Blast:IG_like 146 222 8e-19 BLAST
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194797
AA Change: L225Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709
AA Change: L225Q

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered natural killer (NK) cell cytolysis. Mice homozygous for an ENU-generated allele exhibit reduced 'missing-self' targets recognition and elimination and increased clearance of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Cd244
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cd244 APN 1 171574370 critical splice donor site probably null
IGL01014:Cd244 APN 1 171574288 missense probably damaging 1.00
IGL01689:Cd244 APN 1 171582894 intron probably benign
IGL02327:Cd244 APN 1 171559341 missense probably benign 0.36
R0022:Cd244 UTSW 1 171573762 missense probably benign 0.03
R0930:Cd244 UTSW 1 171577233 splice site probably null
R1055:Cd244 UTSW 1 171577276 missense probably damaging 0.99
R4587:Cd244 UTSW 1 171577879 missense probably benign 0.05
R5517:Cd244 UTSW 1 171577974 splice site probably benign
R5929:Cd244 UTSW 1 171559367 missense probably damaging 1.00
R5996:Cd244 UTSW 1 171581640 splice site probably null
R6346:Cd244 UTSW 1 171577321 missense probably damaging 1.00
R6502:Cd244 UTSW 1 171577879 missense probably benign 0.05
R6612:Cd244 UTSW 1 171574104 missense probably benign 0.05
R6701:Cd244 UTSW 1 171574155 missense possibly damaging 0.67
R6973:Cd244 UTSW 1 171574207 missense probably damaging 1.00
R7656:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7672:Cd244 UTSW 1 171577285 missense probably benign 0.28
R7769:Cd244 UTSW 1 171577305 missense probably benign 0.24
RF004:Cd244 UTSW 1 171577922 missense probably benign 0.15
Z1177:Cd244 UTSW 1 171574350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGTAAGCAGCACCAGTC -3'
(R):5'- CTCCCAGGAAAAGAAGATGCTG -3'

Sequencing Primer
(F):5'- TGAGTAAGCAGCACCAGTCTTCTG -3'
(R):5'- CCAGGAAAAGAAGATGCTGTGTTTAG -3'
Posted On2019-11-12