Incidental Mutation 'R7655:Olfr419'
ID591112
Institutional Source Beutler Lab
Gene Symbol Olfr419
Ensembl Gene ENSMUSG00000050788
Gene Nameolfactory receptor 419
SynonymsMOR267-6, GA_x6K02T2P20D-20891507-20892448
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location174248514-174252061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 174250218 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 236 (K236N)
Ref Sequence ENSEMBL: ENSMUSP00000149512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000061990] [ENSMUST00000214725]
Predicted Effect probably benign
Transcript: ENSMUST00000027817
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000061990
AA Change: K236N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050893
Gene: ENSMUSG00000050788
AA Change: K236N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-53 PFAM
Pfam:7tm_1 41 290 3.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214725
AA Change: K236N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Olfr419
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Olfr419 APN 1 174250526 missense probably benign 0.41
IGL01765:Olfr419 APN 1 174250137 missense probably damaging 1.00
IGL02718:Olfr419 APN 1 174250707 nonsense probably null
IGL03208:Olfr419 APN 1 174250393 missense probably damaging 1.00
R1406:Olfr419 UTSW 1 174250861 missense possibly damaging 0.51
R1406:Olfr419 UTSW 1 174250861 missense possibly damaging 0.51
R1760:Olfr419 UTSW 1 174250360 missense probably damaging 0.99
R2138:Olfr419 UTSW 1 174250736 unclassified probably null
R2139:Olfr419 UTSW 1 174250736 unclassified probably null
R2869:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2869:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2871:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2871:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2872:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2872:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2873:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2874:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R3854:Olfr419 UTSW 1 174250150 missense probably damaging 1.00
R4614:Olfr419 UTSW 1 174250622 missense possibly damaging 0.93
R4858:Olfr419 UTSW 1 174250696 missense probably damaging 1.00
R5015:Olfr419 UTSW 1 174250882 missense possibly damaging 0.91
R5138:Olfr419 UTSW 1 174250829 missense probably damaging 0.97
R5296:Olfr419 UTSW 1 174250756 missense possibly damaging 0.75
R5369:Olfr419 UTSW 1 174250441 missense probably damaging 1.00
R6285:Olfr419 UTSW 1 174250829 missense possibly damaging 0.62
R7656:Olfr419 UTSW 1 174250218 missense probably damaging 1.00
R7753:Olfr419 UTSW 1 174250670 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCGGAAAGCATTTCTCAGAGC -3'
(R):5'- GCAGCTCCCATGAAATCCAG -3'

Sequencing Primer
(F):5'- GGAAAGCATTTCTCAGAGCTGTCTG -3'
(R):5'- CATGAAATCCAGCACTTTTTCTGTG -3'
Posted On2019-11-12