Mutagenetix > Incidental Mutations

Incidental Mutation 'R7655:Olfr419'

591112

Institutional Source

Beutler Lab

Gene Symbol

Olfr419

Ensembl Gene

ENSMUSG00000050788

Gene Name

olfactory receptor 419

Synonyms

MOR267-6, GA_x6K02T2P20D-20891507-20892448

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R7655 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

174248514-174252061 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 174250218 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 236 (K236N)

Ref Sequence

ENSEMBL: ENSMUSP00000149512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000061990] [ENSMUST00000214725]

Predicted Effect

probably benign
Transcript: ENSMUST00000027817

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000061990
AA Change: K236N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000050893
Gene: ENSMUSG00000050788
AA Change: K236N

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	1.4e-53	PFAM
Pfam:7tm_1	41	290	3.2e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214725
AA Change: K236N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	A	G	12: 83,992,917	Y400C	probably benign	Het
Agbl1	A	G	7: 76,409,332	M237V		Het
Arntl2	A	G	6: 146,806,442	T21A	probably benign	Het
Atrnl1	C	A	19: 57,611,379	S9*	probably null	Het
BC031181	A	T	18: 75,009,335	K71*	probably null	Het
Brpf1	A	T	6: 113,314,874	M294L	probably benign	Het
Camk2g	T	G	14: 20,739,342	D382A	possibly damaging	Het
Ccdc33	T	A	9: 58,118,465	R94W	probably damaging	Het
Cd244	T	A	1: 171,577,255	L225Q	probably damaging	Het
Chsy1	G	T	7: 66,171,030	V338F	probably damaging	Het
Col14a1	A	G	15: 55,362,450	I170V	unknown	Het
Col6a2	G	T	10: 76,607,756	Q492K	probably benign	Het
Dnah12	G	T	14: 26,859,316	V3168L	probably benign	Het
Dnah7a	T	C	1: 53,496,005	S2699G	possibly damaging	Het
Fam206a	A	G	4: 56,804,218	I78V	probably benign	Het
Fsip2	A	G	2: 82,977,542	K1402E	possibly damaging	Het
Ghdc	C	T	11: 100,769,667	A127T	probably benign	Het
Glp1r	T	C	17: 30,930,598		probably null	Het
Gm15922	T	C	7: 3,739,282	E82G	probably damaging	Het
Gm19410	A	T	8: 35,809,099	M1637L	probably benign	Het
Gm906	T	G	13: 50,247,086	K401N	probably benign	Het
Grm5	T	G	7: 88,130,251	D998E	probably benign	Het
Krtcap3	A	G	5: 31,252,560	T157A	probably damaging	Het
Luc7l2	A	G	6: 38,603,464	R333G	unknown	Het
Mdc1	T	G	17: 35,850,881	S895R	probably benign	Het
Mef2a	G	A	7: 67,295,394	T80M	probably damaging	Het
Mitd1	T	A	1: 37,885,275	I65F	probably benign	Het
Mms19	A	G	19: 41,944,572	L1026P	probably damaging	Het
Mtbp	G	T	15: 55,609,526	V629L	unknown	Het
Ncapd3	T	A	9: 27,055,505	I545N	possibly damaging	Het
Nin	G	A	12: 70,042,768	T1291M		Het
Olfr1487	A	T	19: 13,619,833	I181F	probably damaging	Het
Orc3	G	T	4: 34,587,032	C352*	probably null	Het
Oxct2b	G	A	4: 123,117,757	G490D	probably benign	Het
Pcdhb16	A	T	18: 37,479,405	T473S	probably benign	Het
Phkg2	G	A	7: 127,582,902	G365D	probably damaging	Het
Ppp2r3a	A	T	9: 101,211,712	F471I	probably benign	Het
Prl3d1	T	C	13: 27,100,035	C196R	possibly damaging	Het
Prmt1	A	T	7: 44,984,128	F14L	probably benign	Het
Prox1	A	G	1: 190,162,221	L9P	probably damaging	Het
Ptpn13	T	A	5: 103,540,983	F881I	probably benign	Het
Rab3ip	A	G	10: 116,914,139	I363T	probably benign	Het
Rapgef3	T	C	15: 97,761,209	E134G	probably damaging	Het
Rapgef6	C	T	11: 54,694,453	P1559L	probably benign	Het
Rnf180	T	C	13: 105,167,588	K507E	probably damaging	Het
Rpl3l	T	C	17: 24,730,986	I53T	probably benign	Het
Rtl1	T	C	12: 109,591,008	I1466V	unknown	Het
Saxo2	A	G	7: 82,635,351	Y100H	probably damaging	Het
Selenoh	G	T	2: 84,670,380	R39S	probably damaging	Het
Sgsm2	A	G	11: 74,865,497	V342A	probably damaging	Het
Slc26a9	T	A	1: 131,763,244	F587I	possibly damaging	Het
Smoc1	A	T	12: 81,105,908	Q91L	possibly damaging	Het
Spag9	A	C	11: 93,996,563	H98P	possibly damaging	Het
T2	T	A	17: 8,418,215	C337*	probably null	Het
Tbc1d19	A	G	5: 53,897,035	Y455C	probably damaging	Het
Thbd	A	G	2: 148,407,420	L176P	probably damaging	Het
Tmem116	A	G	5: 121,452,189		probably null	Het
Tmem25	C	T	9: 44,798,343	V54I	possibly damaging	Het
Trpm4	C	T	7: 45,321,809	V378I	probably benign	Het
Trrap	G	T	5: 144,842,612	W3129C	probably damaging	Het
Ttn	A	T	2: 76,728,316	D29740E	probably damaging	Het
Vcan	C	T	13: 89,685,114	C3073Y	probably damaging	Het
Xrra1	T	A	7: 99,910,982	D388E	probably benign	Het

Other mutations in Olfr419

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Olfr419	APN	1	174250526	missense	probably benign	0.41
IGL01765:Olfr419	APN	1	174250137	missense	probably damaging	1.00
IGL02718:Olfr419	APN	1	174250707	nonsense	probably null
IGL03208:Olfr419	APN	1	174250393	missense	probably damaging	1.00
R1406:Olfr419	UTSW	1	174250861	missense	possibly damaging	0.51
R1406:Olfr419	UTSW	1	174250861	missense	possibly damaging	0.51
R1760:Olfr419	UTSW	1	174250360	missense	probably damaging	0.99
R2138:Olfr419	UTSW	1	174250736	unclassified	probably null
R2139:Olfr419	UTSW	1	174250736	unclassified	probably null
R2869:Olfr419	UTSW	1	174250526	missense	probably benign	0.41
R2869:Olfr419	UTSW	1	174250526	missense	probably benign	0.41
R2871:Olfr419	UTSW	1	174250526	missense	probably benign	0.41
R2871:Olfr419	UTSW	1	174250526	missense	probably benign	0.41
R2872:Olfr419	UTSW	1	174250526	missense	probably benign	0.41
R2872:Olfr419	UTSW	1	174250526	missense	probably benign	0.41
R2873:Olfr419	UTSW	1	174250526	missense	probably benign	0.41
R2874:Olfr419	UTSW	1	174250526	missense	probably benign	0.41
R3854:Olfr419	UTSW	1	174250150	missense	probably damaging	1.00
R4614:Olfr419	UTSW	1	174250622	missense	possibly damaging	0.93
R4858:Olfr419	UTSW	1	174250696	missense	probably damaging	1.00
R5015:Olfr419	UTSW	1	174250882	missense	possibly damaging	0.91
R5138:Olfr419	UTSW	1	174250829	missense	probably damaging	0.97
R5296:Olfr419	UTSW	1	174250756	missense	possibly damaging	0.75
R5369:Olfr419	UTSW	1	174250441	missense	probably damaging	1.00
R6285:Olfr419	UTSW	1	174250829	missense	possibly damaging	0.62
R7656:Olfr419	UTSW	1	174250218	missense	probably damaging	1.00
R7753:Olfr419	UTSW	1	174250670	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCGGAAAGCATTTCTCAGAGC -3'
(R):5'- GCAGCTCCCATGAAATCCAG -3'

Sequencing Primer
(F):5'- GGAAAGCATTTCTCAGAGCTGTCTG -3'
(R):5'- CATGAAATCCAGCACTTTTTCTGTG -3'

Posted On

2019-11-12