Incidental Mutation 'R7655:Thbd'
ID591117
Institutional Source Beutler Lab
Gene Symbol Thbd
Ensembl Gene ENSMUSG00000074743
Gene Namethrombomodulin
SynonymsCD141, TM
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location148404466-148408188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148407420 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 176 (L176P)
Ref Sequence ENSEMBL: ENSMUSP00000096877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099270]
Predicted Effect probably damaging
Transcript: ENSMUST00000099270
AA Change: L176P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096877
Gene: ENSMUSG00000074743
AA Change: L176P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
CLECT 24 166 2.78e-18 SMART
EGF 243 280 2.2e1 SMART
EGF 286 323 1.47e-3 SMART
EGF_CA 324 362 7.81e-8 SMART
EGF 367 404 3.57e-2 SMART
EGF 406 439 2.53e1 SMART
EGF 443 480 2.39e1 SMART
low complexity region 490 511 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is an endothelial-specific type I membrane receptor that binds thrombin. This binding results in the activation of protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated. Mutations in this gene are a cause of thromboembolic disease, also known as inherited thrombophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants are growth retarded and die by embryonic day 9.5. Embryos develop further in vitro than in vivo suggesting maternal-fetal incompatibility. Endothelial cell-specific, conditional knockouts suffer fatal juvenile thromboses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Thbd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Thbd APN 2 148407682 nonsense probably null
IGL01510:Thbd APN 2 148406974 missense probably damaging 1.00
IGL01845:Thbd APN 2 148407096 missense probably benign
IGL01892:Thbd APN 2 148407068 missense possibly damaging 0.68
IGL02039:Thbd APN 2 148406542 missense probably benign 0.05
IGL02261:Thbd APN 2 148406481 missense probably benign
IGL02941:Thbd APN 2 148407034 missense probably damaging 1.00
IGL03110:Thbd APN 2 148406796 missense probably benign
IGL03111:Thbd APN 2 148406472 missense probably benign 0.00
F5770:Thbd UTSW 2 148407190 missense probably benign 0.05
PIT4283001:Thbd UTSW 2 148407083 missense probably benign 0.19
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R1847:Thbd UTSW 2 148407684 nonsense probably null
R1957:Thbd UTSW 2 148406979 missense probably damaging 0.97
R2320:Thbd UTSW 2 148406646 missense probably damaging 1.00
R2362:Thbd UTSW 2 148406364 missense probably damaging 1.00
R2900:Thbd UTSW 2 148406214 makesense probably null
R3623:Thbd UTSW 2 148406973 missense probably damaging 1.00
R4839:Thbd UTSW 2 148406671 missense probably damaging 1.00
R4936:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5296:Thbd UTSW 2 148406983 missense probably damaging 1.00
R5521:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5677:Thbd UTSW 2 148407366 missense probably damaging 1.00
R6581:Thbd UTSW 2 148406272 missense probably benign
R7139:Thbd UTSW 2 148406541 missense probably benign 0.37
R7246:Thbd UTSW 2 148406485 missense probably benign
R7656:Thbd UTSW 2 148407420 missense probably damaging 1.00
R7752:Thbd UTSW 2 148406974 missense probably damaging 0.99
R7867:Thbd UTSW 2 148407744 missense probably damaging 1.00
R7950:Thbd UTSW 2 148407744 missense probably damaging 1.00
V7582:Thbd UTSW 2 148407190 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTCCACGCTGCAATTCCAG -3'
(R):5'- ACACCAGTTACAGCAGGTGG -3'

Sequencing Primer
(F):5'- GCAATTCCAGGCTCCTGTCG -3'
(R):5'- TACAGCAGGTGGGCGCG -3'
Posted On2019-11-12