Mutagenetix > Incidental Mutation

Incidental Mutation 'R7655:Ptpn13'

591123

Institutional Source

Beutler Lab

Gene Symbol

Ptpn13

Ensembl Gene

ENSMUSG00000034573

Gene Name

protein tyrosine phosphatase, non-receptor type 13

Synonyms

PTPL1, Ptpri, PTP-BL

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R7655 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103425192-103598303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103540983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 881 (F881I)

Ref Sequence

ENSEMBL: ENSMUSP00000048119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048957]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048957
AA Change: F881I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: F881I

Domain	Start	End	E-Value	Type
KIND	3	190	2.3e-80	SMART
Blast:B41	340	447	6e-34	BLAST
coiled coil region	460	487	N/A	INTRINSIC
B41	561	774	3.3e-68	SMART
FERM_C	780	869	3.2e-35	SMART
low complexity region	1049	1058	N/A	INTRINSIC
PDZ	1093	1170	7.6e-25	SMART
low complexity region	1224	1236	N/A	INTRINSIC
low complexity region	1309	1322	N/A	INTRINSIC
low complexity region	1331	1341	N/A	INTRINSIC
PDZ	1365	1442	1.7e-24	SMART
low complexity region	1450	1468	N/A	INTRINSIC
PDZ	1499	1579	3.5e-19	SMART
PDZ	1773	1845	1.2e-21	SMART
PDZ	1867	1942	1.6e-16	SMART
low complexity region	2123	2134	N/A	INTRINSIC
PTPc	2179	2436	6.9e-113	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	A	G	12: 83,992,917	Y400C	probably benign	Het
Agbl1	A	G	7: 76,409,332	M237V		Het
Arntl2	A	G	6: 146,806,442	T21A	probably benign	Het
Atrnl1	C	A	19: 57,611,379	S9*	probably null	Het
BC031181	A	T	18: 75,009,335	K71*	probably null	Het
Brpf1	A	T	6: 113,314,874	M294L	probably benign	Het
Camk2g	T	G	14: 20,739,342	D382A	possibly damaging	Het
Ccdc33	T	A	9: 58,118,465	R94W	probably damaging	Het
Cd244	T	A	1: 171,577,255	L225Q	probably damaging	Het
Chsy1	G	T	7: 66,171,030	V338F	probably damaging	Het
Col14a1	A	G	15: 55,362,450	I170V	unknown	Het
Col6a2	G	T	10: 76,607,756	Q492K	probably benign	Het
Dnah12	G	T	14: 26,859,316	V3168L	probably benign	Het
Dnah7a	T	C	1: 53,496,005	S2699G	possibly damaging	Het
Fam206a	A	G	4: 56,804,218	I78V	probably benign	Het
Fsip2	A	G	2: 82,977,542	K1402E	possibly damaging	Het
Ghdc	C	T	11: 100,769,667	A127T	probably benign	Het
Glp1r	T	C	17: 30,930,598		probably null	Het
Gm15922	T	C	7: 3,739,282	E82G	probably damaging	Het
Gm19410	A	T	8: 35,809,099	M1637L	probably benign	Het
Gm906	T	G	13: 50,247,086	K401N	probably benign	Het
Grm5	T	G	7: 88,130,251	D998E	probably benign	Het
Krtcap3	A	G	5: 31,252,560	T157A	probably damaging	Het
Luc7l2	A	G	6: 38,603,464	R333G	unknown	Het
Mdc1	T	G	17: 35,850,881	S895R	probably benign	Het
Mef2a	G	A	7: 67,295,394	T80M	probably damaging	Het
Mitd1	T	A	1: 37,885,275	I65F	probably benign	Het
Mms19	A	G	19: 41,944,572	L1026P	probably damaging	Het
Mtbp	G	T	15: 55,609,526	V629L	unknown	Het
Ncapd3	T	A	9: 27,055,505	I545N	possibly damaging	Het
Nin	G	A	12: 70,042,768	T1291M		Het
Olfr1487	A	T	19: 13,619,833	I181F	probably damaging	Het
Olfr419	T	A	1: 174,250,218	K236N	probably damaging	Het
Orc3	G	T	4: 34,587,032	C352*	probably null	Het
Oxct2b	G	A	4: 123,117,757	G490D	probably benign	Het
Pcdhb16	A	T	18: 37,479,405	T473S	probably benign	Het
Phkg2	G	A	7: 127,582,902	G365D	probably damaging	Het
Ppp2r3a	A	T	9: 101,211,712	F471I	probably benign	Het
Prl3d1	T	C	13: 27,100,035	C196R	possibly damaging	Het
Prmt1	A	T	7: 44,984,128	F14L	probably benign	Het
Prox1	A	G	1: 190,162,221	L9P	probably damaging	Het
Rab3ip	A	G	10: 116,914,139	I363T	probably benign	Het
Rapgef3	T	C	15: 97,761,209	E134G	probably damaging	Het
Rapgef6	C	T	11: 54,694,453	P1559L	probably benign	Het
Rnf180	T	C	13: 105,167,588	K507E	probably damaging	Het
Rpl3l	T	C	17: 24,730,986	I53T	probably benign	Het
Rtl1	T	C	12: 109,591,008	I1466V	unknown	Het
Saxo2	A	G	7: 82,635,351	Y100H	probably damaging	Het
Selenoh	G	T	2: 84,670,380	R39S	probably damaging	Het
Sgsm2	A	G	11: 74,865,497	V342A	probably damaging	Het
Slc26a9	T	A	1: 131,763,244	F587I	possibly damaging	Het
Smoc1	A	T	12: 81,105,908	Q91L	possibly damaging	Het
Spag9	A	C	11: 93,996,563	H98P	possibly damaging	Het
T2	T	A	17: 8,418,215	C337*	probably null	Het
Tbc1d19	A	G	5: 53,897,035	Y455C	probably damaging	Het
Thbd	A	G	2: 148,407,420	L176P	probably damaging	Het
Tmem116	A	G	5: 121,452,189		probably null	Het
Tmem25	C	T	9: 44,798,343	V54I	possibly damaging	Het
Trpm4	C	T	7: 45,321,809	V378I	probably benign	Het
Trrap	G	T	5: 144,842,612	W3129C	probably damaging	Het
Ttn	A	T	2: 76,728,316	D29740E	probably damaging	Het
Vcan	C	T	13: 89,685,114	C3073Y	probably damaging	Het
Xrra1	T	A	7: 99,910,982	D388E	probably benign	Het

Other mutations in Ptpn13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ptpn13	APN	5	103551058	missense	probably damaging	1.00
IGL00569:Ptpn13	APN	5	103591006	splice site	probably benign
IGL00764:Ptpn13	APN	5	103597718	missense	probably damaging	1.00
IGL00805:Ptpn13	APN	5	103554729	missense	probably benign	0.33
IGL00922:Ptpn13	APN	5	103588088	missense	probably damaging	1.00
IGL00959:Ptpn13	APN	5	103517571	critical splice donor site	probably null
IGL01090:Ptpn13	APN	5	103541314	missense	probably null	0.80
IGL01352:Ptpn13	APN	5	103486775	splice site	probably null
IGL01510:Ptpn13	APN	5	103562300	missense	probably damaging	1.00
IGL01515:Ptpn13	APN	5	103556113	missense	probably benign	0.06
IGL01896:Ptpn13	APN	5	103501523	missense	possibly damaging	0.78
IGL02094:Ptpn13	APN	5	103594617	missense	probably damaging	1.00
IGL02561:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02562:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02567:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02604:Ptpn13	APN	5	103501903	missense	probably benign	0.01
IGL02679:Ptpn13	APN	5	103569454	missense	possibly damaging	0.55
IGL02981:Ptpn13	APN	5	103528804	missense	probably damaging	1.00
IGL03131:Ptpn13	APN	5	103517559	missense	probably benign
IGL03136:Ptpn13	APN	5	103543463	missense	possibly damaging	0.49
IGL03163:Ptpn13	APN	5	103591346	missense	probably damaging	1.00
IGL03271:Ptpn13	APN	5	103462148	missense	probably damaging	1.00
IGL03297:Ptpn13	APN	5	103541077	missense	probably benign	0.13
IGL03328:Ptpn13	APN	5	103516348	missense	probably benign	0.00
IGL03343:Ptpn13	APN	5	103554950	missense	possibly damaging	0.88
IGL02835:Ptpn13	UTSW	5	103560025	missense	probably damaging	0.98
P0021:Ptpn13	UTSW	5	103528820	missense	probably benign	0.39
R0017:Ptpn13	UTSW	5	103486772	critical splice donor site	probably null
R0090:Ptpn13	UTSW	5	103569503	missense	probably damaging	1.00
R0111:Ptpn13	UTSW	5	103580763	splice site	probably benign
R0183:Ptpn13	UTSW	5	103516408	missense	probably benign	0.00
R0230:Ptpn13	UTSW	5	103527131	missense	probably damaging	1.00
R0302:Ptpn13	UTSW	5	103565225	missense	probably benign
R0360:Ptpn13	UTSW	5	103533348	missense	probably damaging	1.00
R0364:Ptpn13	UTSW	5	103533348	missense	probably damaging	1.00
R0388:Ptpn13	UTSW	5	103555062	missense	probably benign	0.31
R0504:Ptpn13	UTSW	5	103501496	missense	possibly damaging	0.92
R0558:Ptpn13	UTSW	5	103529717	missense	probably damaging	0.99
R0562:Ptpn13	UTSW	5	103516425	critical splice donor site	probably null
R0568:Ptpn13	UTSW	5	103489765	missense	probably damaging	1.00
R0609:Ptpn13	UTSW	5	103556145	missense	probably benign
R0669:Ptpn13	UTSW	5	103556109	missense	probably benign
R0739:Ptpn13	UTSW	5	103575132	missense	probably benign
R1006:Ptpn13	UTSW	5	103586789	missense	probably benign	0.04
R1164:Ptpn13	UTSW	5	103489773	missense	probably damaging	1.00
R1274:Ptpn13	UTSW	5	103550260	missense	probably damaging	0.98
R1501:Ptpn13	UTSW	5	103516364	missense	probably benign	0.01
R1529:Ptpn13	UTSW	5	103564132	missense	probably benign	0.00
R1533:Ptpn13	UTSW	5	103556178	nonsense	probably null
R1613:Ptpn13	UTSW	5	103536871	missense	possibly damaging	0.89
R1616:Ptpn13	UTSW	5	103565237	missense	possibly damaging	0.49
R1830:Ptpn13	UTSW	5	103543459	missense	probably benign	0.00
R1892:Ptpn13	UTSW	5	103501679	missense	possibly damaging	0.92
R1907:Ptpn13	UTSW	5	103580709	missense	probably null	0.45
R2143:Ptpn13	UTSW	5	103556133	missense	probably benign
R2145:Ptpn13	UTSW	5	103556133	missense	probably benign
R2151:Ptpn13	UTSW	5	103525785	missense	probably damaging	1.00
R2180:Ptpn13	UTSW	5	103569558	missense	probably damaging	1.00
R2264:Ptpn13	UTSW	5	103489661	missense	possibly damaging	0.96
R2313:Ptpn13	UTSW	5	103564161	missense	probably damaging	1.00
R3522:Ptpn13	UTSW	5	103589854	splice site	probably benign
R3773:Ptpn13	UTSW	5	103477121	missense	probably damaging	1.00
R3924:Ptpn13	UTSW	5	103550741	splice site	probably benign
R4289:Ptpn13	UTSW	5	103533285	missense	probably damaging	1.00
R4348:Ptpn13	UTSW	5	103569726	missense	probably damaging	1.00
R4385:Ptpn13	UTSW	5	103533407	splice site	probably null
R4526:Ptpn13	UTSW	5	103501469	missense	probably benign	0.32
R4557:Ptpn13	UTSW	5	103541110	missense	probably damaging	1.00
R4596:Ptpn13	UTSW	5	103523692	missense	probably benign	0.06
R4632:Ptpn13	UTSW	5	103569860	missense	possibly damaging	0.46
R4727:Ptpn13	UTSW	5	103569855	missense	probably benign
R4780:Ptpn13	UTSW	5	103586773	missense	probably benign	0.04
R4793:Ptpn13	UTSW	5	103582778	critical splice donor site	probably null
R4812:Ptpn13	UTSW	5	103523615	missense	probably benign	0.00
R4939:Ptpn13	UTSW	5	103517469	splice site	probably null
R4951:Ptpn13	UTSW	5	103588046	missense	probably benign	0.00
R5052:Ptpn13	UTSW	5	103561980	missense	probably damaging	1.00
R5148:Ptpn13	UTSW	5	103492232	missense	probably damaging	1.00
R5309:Ptpn13	UTSW	5	103541053	missense	probably damaging	1.00
R5521:Ptpn13	UTSW	5	103501428	missense	probably benign	0.03
R5545:Ptpn13	UTSW	5	103561964	missense	probably damaging	1.00
R5696:Ptpn13	UTSW	5	103554759	missense	probably benign	0.20
R5735:Ptpn13	UTSW	5	103554820	missense	probably benign	0.03
R5815:Ptpn13	UTSW	5	103597690	splice site	probably null
R5876:Ptpn13	UTSW	5	103476960	missense	probably damaging	1.00
R5878:Ptpn13	UTSW	5	103477118	missense	possibly damaging	0.89
R6366:Ptpn13	UTSW	5	103551053	missense	probably damaging	1.00
R6455:Ptpn13	UTSW	5	103541284	missense	probably benign	0.00
R6492:Ptpn13	UTSW	5	103501612	missense	probably benign	0.02
R6709:Ptpn13	UTSW	5	103586756	missense	probably benign	0.18
R6759:Ptpn13	UTSW	5	103565255	missense	possibly damaging	0.49
R6944:Ptpn13	UTSW	5	103476991	missense	probably null	1.00
R7079:Ptpn13	UTSW	5	103501886	missense	probably benign	0.00
R7253:Ptpn13	UTSW	5	103565284	missense	possibly damaging	0.68
R7254:Ptpn13	UTSW	5	103594636	missense	probably damaging	1.00
R7391:Ptpn13	UTSW	5	103540981	missense	probably damaging	1.00
R7451:Ptpn13	UTSW	5	103527095	missense	probably benign	0.16
R7614:Ptpn13	UTSW	5	103501465	missense	probably benign	0.13
R7652:Ptpn13	UTSW	5	103529712	missense	probably benign	0.12
R7656:Ptpn13	UTSW	5	103540983	missense	probably benign	0.00
R7683:Ptpn13	UTSW	5	103565152	missense	probably benign	0.01
R7734:Ptpn13	UTSW	5	103561962	missense	probably damaging	1.00
R7794:Ptpn13	UTSW	5	103492224	missense	probably benign	0.06
R7834:Ptpn13	UTSW	5	103462148	missense	probably damaging	1.00
R7911:Ptpn13	UTSW	5	103541058	missense	probably damaging	1.00
R8010:Ptpn13	UTSW	5	103559937	nonsense	probably null
R8308:Ptpn13	UTSW	5	103540972	missense	probably damaging	0.99
R8493:Ptpn13	UTSW	5	103564165	missense	probably damaging	1.00
R8493:Ptpn13	UTSW	5	103569805	missense	probably benign	0.01
R8507:Ptpn13	UTSW	5	103557949	missense	probably damaging	1.00
R8556:Ptpn13	UTSW	5	103559172	missense	probably damaging	1.00
R8924:Ptpn13	UTSW	5	103591235	missense	probably damaging	1.00
R8933:Ptpn13	UTSW	5	103579805	missense	probably benign	0.00
R8958:Ptpn13	UTSW	5	103551107	missense	probably benign	0.15
R8975:Ptpn13	UTSW	5	103501400	missense	probably benign	0.32
R9080:Ptpn13	UTSW	5	103489628	missense	probably damaging	0.99
R9091:Ptpn13	UTSW	5	103501869	missense	possibly damaging	0.67
R9219:Ptpn13	UTSW	5	103597766	missense	probably benign	0.16
R9270:Ptpn13	UTSW	5	103501869	missense	possibly damaging	0.67
R9577:Ptpn13	UTSW	5	103528809	missense	probably damaging	1.00
R9593:Ptpn13	UTSW	5	103527132	missense	possibly damaging	0.94
RF017:Ptpn13	UTSW	5	103593580	missense	probably benign	0.45
Z1177:Ptpn13	UTSW	5	103569556	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGTAGGAAATGCTTAGGCTTAG -3'
(R):5'- TTCTGCAGGGGCTGGTAAAG -3'

Sequencing Primer
(F):5'- GCTTAGGCTGGCAAAAGCTC -3'
(R):5'- TGGTAAAGCGACCACTCTG -3'

Posted On

2019-11-12