Incidental Mutation 'R7655:Brpf1'
ID591127
Institutional Source Beutler Lab
Gene Symbol Brpf1
Ensembl Gene ENSMUSG00000001632
Gene Namebromodomain and PHD finger containing, 1
Synonyms4930540D11Rik, 4833438B11Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113307137-113324860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113314874 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 294 (M294L)
Ref Sequence ENSEMBL: ENSMUSP00000108744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113117] [ENSMUST00000113119] [ENSMUST00000113121] [ENSMUST00000113122] [ENSMUST00000203577] [ENSMUST00000204198] [ENSMUST00000204626]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113117
AA Change: M294L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108742
Gene: ENSMUSG00000001632
AA Change: M294L

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 1e-35 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
low complexity region 1078 1090 N/A INTRINSIC
PWWP 1115 1198 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113119
AA Change: M294L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108744
Gene: ENSMUSG00000001632
AA Change: M294L

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 8.5e-39 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
PWWP 1116 1199 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113121
AA Change: M294L

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108746
Gene: ENSMUSG00000001632
AA Change: M294L

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
PWWP 1082 1165 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113122
AA Change: M294L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108747
Gene: ENSMUSG00000001632
AA Change: M294L

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
PWWP 1081 1164 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203577
AA Change: M294L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144820
Gene: ENSMUSG00000001632
AA Change: M294L

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 5.1e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
low complexity region 1084 1096 N/A INTRINSIC
PWWP 1121 1204 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204198
AA Change: M294L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144804
Gene: ENSMUSG00000001632
AA Change: M294L

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.4e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1e-39 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
PWWP 987 1070 2.6e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204626
AA Change: M294L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145093
Gene: ENSMUSG00000001632
AA Change: M294L

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.9e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
PWWP 1087 1170 2.6e-44 SMART
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain, PHD finger and chromo/Tudor-related Pro-Trp-Trp-Pro (PWWP) domain containing protein. The encoded protein is a component of the MOZ/MORF histone acetyltransferase complexes which function as a transcriptional regulators. This protein binds to the catalytic MYST domains of the MOZ and MORF proteins and may play a role in stimulating acetyltransferase and transcriptional activity of the complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality around E9.5 and disrupts histone acetylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Brpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Brpf1 APN 6 113316684 missense probably damaging 0.99
IGL00697:Brpf1 APN 6 113314986 missense probably damaging 1.00
IGL00823:Brpf1 APN 6 113321886 missense probably benign 0.01
IGL00951:Brpf1 APN 6 113322553 missense probably damaging 1.00
IGL01335:Brpf1 APN 6 113319337 missense probably damaging 0.99
IGL01565:Brpf1 APN 6 113316650 missense probably damaging 1.00
IGL02237:Brpf1 APN 6 113310375 missense probably damaging 1.00
R1484:Brpf1 UTSW 6 113315135 missense probably damaging 1.00
R1502:Brpf1 UTSW 6 113322420 missense probably damaging 1.00
R1517:Brpf1 UTSW 6 113319089 missense probably benign 0.17
R1525:Brpf1 UTSW 6 113317154 missense probably damaging 1.00
R1773:Brpf1 UTSW 6 113319931 missense possibly damaging 0.85
R1925:Brpf1 UTSW 6 113319930 missense probably damaging 0.96
R2928:Brpf1 UTSW 6 113322046 missense possibly damaging 0.95
R3900:Brpf1 UTSW 6 113318433 missense probably benign 0.20
R4019:Brpf1 UTSW 6 113310282 missense probably damaging 0.97
R4630:Brpf1 UTSW 6 113309906 missense probably damaging 1.00
R4754:Brpf1 UTSW 6 113320447 missense possibly damaging 0.92
R4757:Brpf1 UTSW 6 113315111 missense probably damaging 1.00
R4858:Brpf1 UTSW 6 113317678 missense possibly damaging 0.56
R4866:Brpf1 UTSW 6 113322470 missense probably damaging 0.97
R5073:Brpf1 UTSW 6 113310254 missense probably damaging 0.97
R5197:Brpf1 UTSW 6 113319941 missense possibly damaging 0.57
R7011:Brpf1 UTSW 6 113318466 missense probably benign 0.00
R7585:Brpf1 UTSW 6 113315046 missense possibly damaging 0.58
R7656:Brpf1 UTSW 6 113314874 missense probably benign 0.02
R8008:Brpf1 UTSW 6 113319089 missense probably benign 0.00
R8222:Brpf1 UTSW 6 113310038 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAAGACTGAGGGTGTAAGTCCC -3'
(R):5'- TGTGTTGGCAAAGCAAACCTC -3'

Sequencing Primer
(F):5'- GGGTGTAAGTCCCATCCCACAAG -3'
(R):5'- CTCAGGGATCCACAAGGC -3'
Posted On2019-11-12