Incidental Mutation 'R7655:Arntl2'
ID591128
Institutional Source Beutler Lab
Gene Symbol Arntl2
Ensembl Gene ENSMUSG00000040187
Gene Namearyl hydrocarbon receptor nuclear translocator-like 2
SynonymsMOP9, 4632430A05Rik, bHLHe6, BMAL2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location146796055-146833529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146806442 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 21 (T21A)
Ref Sequence ENSEMBL: ENSMUSP00000079373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080530] [ENSMUST00000111636] [ENSMUST00000111638] [ENSMUST00000111639] [ENSMUST00000129788]
Predicted Effect probably benign
Transcript: ENSMUST00000080530
AA Change: T21A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079373
Gene: ENSMUSG00000040187
AA Change: T21A

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111636
AA Change: T21A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107263
Gene: ENSMUSG00000040187
AA Change: T21A

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111638
AA Change: T21A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107265
Gene: ENSMUSG00000040187
AA Change: T21A

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 1.29e-4 SMART
PAC 361 404 3.66e0 SMART
low complexity region 417 428 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111639
AA Change: T21A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107266
Gene: ENSMUSG00000040187
AA Change: T21A

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129788
AA Change: T21A

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121170
Gene: ENSMUSG00000040187
AA Change: T21A

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
Meta Mutation Damage Score 0.0942 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix transcription factor belonging to the PAS (Per, Arnt, Sim) superfamily. The PAS proteins play important roles in adaptation to low atmospheric and cellular oxygen levels, exposure to certain environmental pollutants, and diurnal oscillations in light and temperature. This protein forms a transcriptionally active heterodimer with the circadian Clock protein, the structurally related Mop4, and hypoxia-inducible factors, such as Hif1alpha. Consistent with its role as a biologically relevant partner of circadian and hypoxia factors, this protein is coexpressed in regions of the brain such as the thalamus, hypothalamus, and amygdala. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Arntl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Arntl2 APN 6 146827329 splice site probably benign
IGL00481:Arntl2 APN 6 146809666 missense probably benign 0.11
IGL02141:Arntl2 APN 6 146828095 splice site probably benign
IGL02402:Arntl2 APN 6 146809768 missense possibly damaging 0.90
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0131:Arntl2 UTSW 6 146828103 missense probably benign 0.00
R0403:Arntl2 UTSW 6 146822655 missense probably damaging 1.00
R0716:Arntl2 UTSW 6 146829720 missense possibly damaging 0.82
R0799:Arntl2 UTSW 6 146823253 splice site probably benign
R0834:Arntl2 UTSW 6 146822687 missense probably damaging 1.00
R1909:Arntl2 UTSW 6 146810810 missense probably benign 0.01
R2270:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R2272:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R3715:Arntl2 UTSW 6 146822689 missense probably damaging 0.97
R4370:Arntl2 UTSW 6 146809651 missense probably damaging 1.00
R5399:Arntl2 UTSW 6 146822661 missense probably damaging 0.99
R5894:Arntl2 UTSW 6 146823234 missense possibly damaging 0.93
R5972:Arntl2 UTSW 6 146809689 missense probably damaging 0.99
R6090:Arntl2 UTSW 6 146829696 missense possibly damaging 0.90
R6111:Arntl2 UTSW 6 146820599 missense probably benign 0.16
R6279:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6300:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6452:Arntl2 UTSW 6 146823207 missense probably benign 0.00
R6722:Arntl2 UTSW 6 146818900 missense probably damaging 0.99
R7296:Arntl2 UTSW 6 146822134 missense not run
R7335:Arntl2 UTSW 6 146809719 missense probably benign 0.01
R7481:Arntl2 UTSW 6 146818871 missense not run
R7656:Arntl2 UTSW 6 146806442 missense probably benign 0.31
R8015:Arntl2 UTSW 6 146820590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGGCCAGTCTGTGCTTC -3'
(R):5'- TGGCAAGAACTACAGTCTGAG -3'

Sequencing Primer
(F):5'- CCCAGGATCTCAAGTATGCTAGG -3'
(R):5'- TGGCAAGAACTACAGTCTGAGAAATC -3'
Posted On2019-11-12