Incidental Mutation 'R7655:Prmt1'
ID591130
Institutional Source Beutler Lab
Gene Symbol Prmt1
Ensembl Gene ENSMUSG00000109324
Gene Nameprotein arginine N-methyltransferase 1
SynonymsHrmt1l2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44975989-44986568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44984128 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 14 (F14L)
Ref Sequence ENSEMBL: ENSMUSP00000103474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045325] [ENSMUST00000107843] [ENSMUST00000207370] [ENSMUST00000207522] [ENSMUST00000207659] [ENSMUST00000208312] [ENSMUST00000208829] [ENSMUST00000208938] [ENSMUST00000209124]
Predicted Effect probably benign
Transcript: ENSMUST00000045325
SMART Domains Protein: ENSMUSP00000045365
Gene: ENSMUSG00000109324

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 3.9e-11 PFAM
Pfam:Met_10 72 184 5.4e-7 PFAM
Pfam:MTS 78 162 7e-7 PFAM
Pfam:PrmA 79 182 8.1e-10 PFAM
Pfam:Methyltransf_31 86 226 4.1e-10 PFAM
Pfam:Methyltransf_18 88 195 3.5e-9 PFAM
Pfam:Methyltransf_26 89 189 1.4e-8 PFAM
Pfam:Methyltransf_11 93 192 3.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107843
AA Change: F14L

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103474
Gene: ENSMUSG00000109324
AA Change: F14L

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 1.9e-8 PFAM
Pfam:MTS 78 162 1.1e-6 PFAM
Pfam:PrmA 79 181 1.3e-9 PFAM
Pfam:Methyltransf_31 86 226 4e-10 PFAM
Pfam:Methyltransf_18 88 192 6.2e-9 PFAM
Pfam:Methyltransf_11 93 192 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207370
Predicted Effect probably benign
Transcript: ENSMUST00000207522
AA Change: F14L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000207659
Predicted Effect probably benign
Transcript: ENSMUST00000208312
Predicted Effect probably benign
Transcript: ENSMUST00000208778
Predicted Effect probably benign
Transcript: ENSMUST00000208829
Predicted Effect probably benign
Transcript: ENSMUST00000208938
Predicted Effect probably benign
Transcript: ENSMUST00000209056
Predicted Effect probably benign
Transcript: ENSMUST00000209124
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Embryos homozygous for a null mutation die before E6.5 and exhibit abnormal embryonic tissue morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Prmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Prmt1 APN 7 44977635 unclassified probably benign
IGL03195:Prmt1 APN 7 44977571 missense probably damaging 0.98
R0110:Prmt1 UTSW 7 44978801 unclassified probably benign
R0313:Prmt1 UTSW 7 44978748 missense probably benign 0.39
R0326:Prmt1 UTSW 7 44979454 missense probably damaging 1.00
R0522:Prmt1 UTSW 7 44981779 missense probably benign 0.08
R0531:Prmt1 UTSW 7 44977624 missense probably damaging 1.00
R0611:Prmt1 UTSW 7 44978801 splice site probably null
R2002:Prmt1 UTSW 7 44978724 missense probably damaging 1.00
R4712:Prmt1 UTSW 7 44981636 missense probably damaging 1.00
R6032:Prmt1 UTSW 7 44977102 unclassified probably null
R6153:Prmt1 UTSW 7 44981827 missense probably damaging 1.00
R7087:Prmt1 UTSW 7 44981583 splice site probably null
R7216:Prmt1 UTSW 7 44983573 missense probably benign
R7656:Prmt1 UTSW 7 44984128 missense probably benign 0.05
R7747:Prmt1 UTSW 7 44984136 splice site probably null
Z1177:Prmt1 UTSW 7 44979509 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGGAAGGGCTCTGTCCTAAG -3'
(R):5'- CCCTGGCAAGTATTGGGTCTTG -3'

Sequencing Primer
(F):5'- CCTAAGGGGTTAGGGGGCAC -3'
(R):5'- GCAGGCCACCATCTCTTCAG -3'
Posted On2019-11-12