Mutagenetix > Incidental Mutations

Incidental Mutation 'R7655:Trpm4'

591131

Institutional Source

Beutler Lab

Gene Symbol

Trpm4

Ensembl Gene

ENSMUSG00000038260

Gene Name

transient receptor potential cation channel, subfamily M, member 4

Synonyms

LTRPC4, TRPM4B, 1110030C19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R7655 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45302632-45333780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45321809 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 378 (V378I)

Ref Sequence

ENSEMBL: ENSMUSP00000040367 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000210541] [ENSMUST00000211431] [ENSMUST00000211743]

Predicted Effect

probably benign
Transcript: ENSMUST00000042194
AA Change: V378I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260
AA Change: V378I

Domain	Start	End	E-Value	Type
low complexity region	118	131	N/A	INTRINSIC
SCOP:d1awcb_	378	465	2e-3	SMART
low complexity region	600	612	N/A	INTRINSIC
low complexity region	637	645	N/A	INTRINSIC
transmembrane domain	688	710	N/A	INTRINSIC
Pfam:Ion_trans	781	1051	1.8e-13	PFAM
low complexity region	1089	1096	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000210541

Predicted Effect

probably benign
Transcript: ENSMUST00000211431

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211743
AA Change: V231I

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	A	G	12: 83,992,917	Y400C	probably benign	Het
Agbl1	A	G	7: 76,409,332	M237V		Het
Arntl2	A	G	6: 146,806,442	T21A	probably benign	Het
Atrnl1	C	A	19: 57,611,379	S9*	probably null	Het
BC031181	A	T	18: 75,009,335	K71*	probably null	Het
Brpf1	A	T	6: 113,314,874	M294L	probably benign	Het
Camk2g	T	G	14: 20,739,342	D382A	possibly damaging	Het
Ccdc33	T	A	9: 58,118,465	R94W	probably damaging	Het
Cd244	T	A	1: 171,577,255	L225Q	probably damaging	Het
Chsy1	G	T	7: 66,171,030	V338F	probably damaging	Het
Col14a1	A	G	15: 55,362,450	I170V	unknown	Het
Col6a2	G	T	10: 76,607,756	Q492K	probably benign	Het
Dnah12	G	T	14: 26,859,316	V3168L	probably benign	Het
Dnah7a	T	C	1: 53,496,005	S2699G	possibly damaging	Het
Fam206a	A	G	4: 56,804,218	I78V	probably benign	Het
Fsip2	A	G	2: 82,977,542	K1402E	possibly damaging	Het
Ghdc	C	T	11: 100,769,667	A127T	probably benign	Het
Glp1r	T	C	17: 30,930,598		probably null	Het
Gm15922	T	C	7: 3,739,282	E82G	probably damaging	Het
Gm19410	A	T	8: 35,809,099	M1637L	probably benign	Het
Gm906	T	G	13: 50,247,086	K401N	probably benign	Het
Grm5	T	G	7: 88,130,251	D998E	probably benign	Het
Krtcap3	A	G	5: 31,252,560	T157A	probably damaging	Het
Luc7l2	A	G	6: 38,603,464	R333G	unknown	Het
Mdc1	T	G	17: 35,850,881	S895R	probably benign	Het
Mef2a	G	A	7: 67,295,394	T80M	probably damaging	Het
Mitd1	T	A	1: 37,885,275	I65F	probably benign	Het
Mms19	A	G	19: 41,944,572	L1026P	probably damaging	Het
Mtbp	G	T	15: 55,609,526	V629L	unknown	Het
Ncapd3	T	A	9: 27,055,505	I545N	possibly damaging	Het
Nin	G	A	12: 70,042,768	T1291M		Het
Olfr1487	A	T	19: 13,619,833	I181F	probably damaging	Het
Olfr419	T	A	1: 174,250,218	K236N	probably damaging	Het
Orc3	G	T	4: 34,587,032	C352*	probably null	Het
Oxct2b	G	A	4: 123,117,757	G490D	probably benign	Het
Pcdhb16	A	T	18: 37,479,405	T473S	probably benign	Het
Phkg2	G	A	7: 127,582,902	G365D	probably damaging	Het
Ppp2r3a	A	T	9: 101,211,712	F471I	probably benign	Het
Prl3d1	T	C	13: 27,100,035	C196R	possibly damaging	Het
Prmt1	A	T	7: 44,984,128	F14L	probably benign	Het
Prox1	A	G	1: 190,162,221	L9P	probably damaging	Het
Ptpn13	T	A	5: 103,540,983	F881I	probably benign	Het
Rab3ip	A	G	10: 116,914,139	I363T	probably benign	Het
Rapgef3	T	C	15: 97,761,209	E134G	probably damaging	Het
Rapgef6	C	T	11: 54,694,453	P1559L	probably benign	Het
Rnf180	T	C	13: 105,167,588	K507E	probably damaging	Het
Rpl3l	T	C	17: 24,730,986	I53T	probably benign	Het
Rtl1	T	C	12: 109,591,008	I1466V	unknown	Het
Saxo2	A	G	7: 82,635,351	Y100H	probably damaging	Het
Selenoh	G	T	2: 84,670,380	R39S	probably damaging	Het
Sgsm2	A	G	11: 74,865,497	V342A	probably damaging	Het
Slc26a9	T	A	1: 131,763,244	F587I	possibly damaging	Het
Smoc1	A	T	12: 81,105,908	Q91L	possibly damaging	Het
Spag9	A	C	11: 93,996,563	H98P	possibly damaging	Het
T2	T	A	17: 8,418,215	C337*	probably null	Het
Tbc1d19	A	G	5: 53,897,035	Y455C	probably damaging	Het
Thbd	A	G	2: 148,407,420	L176P	probably damaging	Het
Tmem116	A	G	5: 121,452,189		probably null	Het
Tmem25	C	T	9: 44,798,343	V54I	possibly damaging	Het
Trrap	G	T	5: 144,842,612	W3129C	probably damaging	Het
Ttn	A	T	2: 76,728,316	D29740E	probably damaging	Het
Vcan	C	T	13: 89,685,114	C3073Y	probably damaging	Het
Xrra1	T	A	7: 99,910,982	D388E	probably benign	Het

Other mutations in Trpm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Trpm4	APN	7	45318349	missense	probably benign
IGL01327:Trpm4	APN	7	45315073	missense	probably damaging	1.00
IGL02069:Trpm4	APN	7	45319294	missense	probably damaging	1.00
IGL02124:Trpm4	APN	7	45310523	missense	probably damaging	1.00
IGL02141:Trpm4	APN	7	45318179	splice site	probably null
IGL02333:Trpm4	APN	7	45322115	missense	possibly damaging	0.85
IGL02338:Trpm4	APN	7	45326998	missense	probably damaging	1.00
IGL02741:Trpm4	APN	7	45318488	missense	possibly damaging	0.82
R0041:Trpm4	UTSW	7	45304946	critical splice donor site	probably null
R0106:Trpm4	UTSW	7	45319240	critical splice donor site	probably null
R0270:Trpm4	UTSW	7	45319253	missense	possibly damaging	0.45
R0279:Trpm4	UTSW	7	45322048	missense	probably damaging	0.99
R0309:Trpm4	UTSW	7	45308706	missense	probably damaging	1.00
R0539:Trpm4	UTSW	7	45305472	missense	probably damaging	0.99
R0969:Trpm4	UTSW	7	45327907	intron	probably benign
R1454:Trpm4	UTSW	7	45317056	missense	probably damaging	0.99
R1512:Trpm4	UTSW	7	45315044	missense	probably benign	0.07
R1579:Trpm4	UTSW	7	45308597	missense	probably damaging	1.00
R1768:Trpm4	UTSW	7	45308612	missense	probably damaging	0.97
R2847:Trpm4	UTSW	7	45310598	missense	probably damaging	1.00
R3883:Trpm4	UTSW	7	45321998	critical splice donor site	probably null
R3884:Trpm4	UTSW	7	45321998	critical splice donor site	probably null
R4895:Trpm4	UTSW	7	45318058	missense	probably damaging	0.98
R5056:Trpm4	UTSW	7	45308630	missense	probably damaging	0.98
R5060:Trpm4	UTSW	7	45321834	missense	probably damaging	1.00
R5069:Trpm4	UTSW	7	45310469	missense	probably damaging	1.00
R5560:Trpm4	UTSW	7	45310332	missense	probably damaging	1.00
R5783:Trpm4	UTSW	7	45310389	missense	probably benign
R5874:Trpm4	UTSW	7	45327749	missense	probably damaging	1.00
R6176:Trpm4	UTSW	7	45326676	missense	probably damaging	1.00
R6302:Trpm4	UTSW	7	45327719	critical splice donor site	probably null
R6431:Trpm4	UTSW	7	45326568	missense	possibly damaging	0.79
R6762:Trpm4	UTSW	7	45304816	utr 3 prime	probably benign
R6827:Trpm4	UTSW	7	45318628	missense	possibly damaging	0.89
R6845:Trpm4	UTSW	7	45322329	missense	possibly damaging	0.88
R6950:Trpm4	UTSW	7	45319280	missense	probably damaging	0.97
R7126:Trpm4	UTSW	7	45310709	splice site	probably null
R7159:Trpm4	UTSW	7	45327268	splice site	probably null
R7167:Trpm4	UTSW	7	45327719	critical splice donor site	probably null
R7386:Trpm4	UTSW	7	45314640	missense	possibly damaging	0.47
R7516:Trpm4	UTSW	7	45305020	missense	probably damaging	1.00
R7656:Trpm4	UTSW	7	45321809	missense	probably benign	0.00
R7743:Trpm4	UTSW	7	45308338	missense	probably benign	0.14
R7943:Trpm4	UTSW	7	45308681	missense	probably damaging	1.00
R7955:Trpm4	UTSW	7	45319259	missense	probably damaging	1.00
R8060:Trpm4	UTSW	7	45305451	missense	probably damaging	1.00
R8119:Trpm4	UTSW	7	45327128	missense	probably damaging	1.00
R8225:Trpm4	UTSW	7	45305334	missense	probably benign
R8395:Trpm4	UTSW	7	45309210	missense	probably benign	0.00
R8509:Trpm4	UTSW	7	45322361	missense	probably damaging	1.00
X0018:Trpm4	UTSW	7	45314634	missense	possibly damaging	0.61
X0022:Trpm4	UTSW	7	45310511	missense	probably damaging	1.00
Z1177:Trpm4	UTSW	7	45326718	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AACGTCTAGGGAAAACTGACC -3'
(R):5'- CCTAAAGGAGACCCTGAGGTTC -3'

Sequencing Primer
(F):5'- GTCTAGGGAAAACTGACCAACAAC -3'
(R):5'- GTTCTTCAGGCCCAGGTATGC -3'

Posted On

2019-11-12