Incidental Mutation 'R7655:Grm5'
ID591136
Institutional Source Beutler Lab
Gene Symbol Grm5
Ensembl Gene ENSMUSG00000049583
Gene Nameglutamate receptor, metabotropic 5
SynonymsGlu5R, mGluR5, 6430542K11Rik, Gprc1e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R7655 (G1)
Quality Score150.008
Status Not validated
Chromosome7
Chromosomal Location87584168-88134907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88130251 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 998 (D998E)
Ref Sequence ENSEMBL: ENSMUSP00000114927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]
Predicted Effect probably damaging
Transcript: ENSMUST00000107263
AA Change: D966E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: D966E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.4e-97 PFAM
Pfam:Peripla_BP_6 130 332 2.5e-14 PFAM
Pfam:NCD3G 506 557 4.5e-20 PFAM
Pfam:7tm_3 588 824 7.4e-75 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125009
AA Change: D966E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: D966E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.7e-101 PFAM
Pfam:Peripla_BP_6 129 327 5.4e-12 PFAM
Pfam:NCD3G 506 557 3.2e-16 PFAM
Pfam:7tm_3 590 823 3.5e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155358
AA Change: D998E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: D998E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Grm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Grm5 APN 7 88130781 missense probably benign 0.00
IGL00970:Grm5 APN 7 87803896 missense probably damaging 0.97
IGL01286:Grm5 APN 7 87602565 missense probably benign 0.00
IGL01307:Grm5 APN 7 88075012 missense probably damaging 1.00
IGL01603:Grm5 APN 7 87603178 missense probably damaging 1.00
IGL01646:Grm5 APN 7 88040059 missense probably damaging 1.00
IGL01705:Grm5 APN 7 88130046 missense possibly damaging 0.59
IGL02184:Grm5 APN 7 88026442 missense probably damaging 0.98
IGL02504:Grm5 APN 7 88130772 missense probably benign
IGL02689:Grm5 APN 7 87602710 missense probably damaging 1.00
IGL02725:Grm5 APN 7 88074665 missense probably damaging 1.00
IGL02851:Grm5 APN 7 88074710 missense probably damaging 0.98
IGL03106:Grm5 APN 7 88036070 missense probably damaging 1.00
IGL03257:Grm5 APN 7 87602898 missense possibly damaging 0.69
IGL03291:Grm5 APN 7 88130796 missense probably damaging 1.00
R0078:Grm5 UTSW 7 88074977 missense probably damaging 1.00
R0314:Grm5 UTSW 7 87602955 missense probably damaging 0.97
R0318:Grm5 UTSW 7 87602967 missense probably damaging 0.99
R0364:Grm5 UTSW 7 88074386 missense probably damaging 1.00
R0380:Grm5 UTSW 7 88074376 missense possibly damaging 0.92
R0454:Grm5 UTSW 7 88130789 missense probably damaging 1.00
R0494:Grm5 UTSW 7 88130781 missense probably benign 0.00
R0562:Grm5 UTSW 7 87603019 missense probably damaging 1.00
R1695:Grm5 UTSW 7 88036103 missense possibly damaging 0.47
R2012:Grm5 UTSW 7 88074872 missense probably damaging 1.00
R2384:Grm5 UTSW 7 87602728 missense probably damaging 1.00
R2510:Grm5 UTSW 7 88036091 missense probably benign 0.21
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R3861:Grm5 UTSW 7 88129994 missense possibly damaging 0.94
R4451:Grm5 UTSW 7 88075132 critical splice donor site probably null
R4626:Grm5 UTSW 7 88130153 missense probably damaging 1.00
R4728:Grm5 UTSW 7 87975288 missense probably damaging 1.00
R4914:Grm5 UTSW 7 88130129 missense probably benign 0.00
R5122:Grm5 UTSW 7 88074820 missense probably damaging 1.00
R5352:Grm5 UTSW 7 88074850 missense probably damaging 1.00
R5361:Grm5 UTSW 7 88074496 missense probably damaging 1.00
R5684:Grm5 UTSW 7 88130645 missense probably benign
R5715:Grm5 UTSW 7 88130256 missense probably benign 0.05
R5759:Grm5 UTSW 7 88026600 missense probably damaging 0.96
R5844:Grm5 UTSW 7 87804024 missense possibly damaging 0.88
R5889:Grm5 UTSW 7 87603073 missense probably damaging 1.00
R6048:Grm5 UTSW 7 88026550 missense probably damaging 1.00
R6145:Grm5 UTSW 7 88026601 missense probably damaging 1.00
R6232:Grm5 UTSW 7 87602430 unclassified probably benign
R6972:Grm5 UTSW 7 87602923 missense probably benign 0.02
R7072:Grm5 UTSW 7 88074304 missense probably damaging 1.00
R7258:Grm5 UTSW 7 88074706 missense probably damaging 0.96
R7316:Grm5 UTSW 7 87975265 missense probably benign
R7434:Grm5 UTSW 7 88130474 missense probably benign 0.10
R7521:Grm5 UTSW 7 88074272 missense possibly damaging 0.86
R7616:Grm5 UTSW 7 88116201 missense probably benign
R7631:Grm5 UTSW 7 87975305 missense probably damaging 1.00
R7656:Grm5 UTSW 7 88130251 missense probably benign 0.00
R7739:Grm5 UTSW 7 88130058 missense possibly damaging 0.46
R7897:Grm5 UTSW 7 88130861 missense probably benign 0.14
R7980:Grm5 UTSW 7 88130861 missense probably benign 0.14
Z1176:Grm5 UTSW 7 87602715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTGGGCCCAGAATGAG -3'
(R):5'- GCTGCTAATCTGCTCCATGAG -3'

Sequencing Primer
(F):5'- CTGTCTGTCCATATCAACAAGAAGG -3'
(R):5'- ATGAGCGAGCCCTGGGATG -3'
Posted On2019-11-12