Incidental Mutation 'R7655:Phkg2'
ID591138
Institutional Source Beutler Lab
Gene Symbol Phkg2
Ensembl Gene ENSMUSG00000030815
Gene Namephosphorylase kinase, gamma 2 (testis)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location127573340-127583307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127582902 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 365 (G365D)
Ref Sequence ENSEMBL: ENSMUSP00000033086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033086] [ENSMUST00000072155] [ENSMUST00000121004] [ENSMUST00000146383] [ENSMUST00000154891] [ENSMUST00000205633]
Predicted Effect probably damaging
Transcript: ENSMUST00000033086
AA Change: G365D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033086
Gene: ENSMUSG00000030815
AA Change: G365D

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121004
AA Change: G365D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113533
Gene: ENSMUSG00000030815
AA Change: G365D

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146383
SMART Domains Protein: ENSMUSP00000115593
Gene: ENSMUSG00000030815

DomainStartEndE-ValueType
Pfam:Pkinase 24 85 8.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154891
SMART Domains Protein: ENSMUSP00000116860
Gene: ENSMUSG00000030815

DomainStartEndE-ValueType
Pfam:Pkinase 24 78 4.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205633
Predicted Effect probably benign
Transcript: ENSMUST00000205839
Predicted Effect probably benign
Transcript: ENSMUST00000206818
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Phkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Phkg2 APN 7 127582340 missense probably damaging 1.00
IGL02259:Phkg2 APN 7 127582286 intron probably benign
IGL02699:Phkg2 APN 7 127582550 missense probably benign
IGL03039:Phkg2 APN 7 127579694 nonsense probably null
R0326:Phkg2 UTSW 7 127573903 missense probably damaging 1.00
R2141:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2142:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2763:Phkg2 UTSW 7 127579833 missense probably benign 0.00
R4614:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4615:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4616:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4666:Phkg2 UTSW 7 127577984 missense possibly damaging 0.93
R4981:Phkg2 UTSW 7 127582379 missense probably damaging 1.00
R4993:Phkg2 UTSW 7 127573941 missense probably damaging 1.00
R5287:Phkg2 UTSW 7 127582757 frame shift probably null
R5416:Phkg2 UTSW 7 127582935 missense possibly damaging 0.46
R7276:Phkg2 UTSW 7 127582386 missense possibly damaging 0.80
R7656:Phkg2 UTSW 7 127582902 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATACTGTCCCTTTCCCAGGTG -3'
(R):5'- AGGTCTGAGTCCCAAACAGTTG -3'

Sequencing Primer
(F):5'- TGGCAGTGTGGACAATACTG -3'
(R):5'- AGCCTCATCCTCTGTGAT -3'
Posted On2019-11-12