Mutagenetix > Incidental Mutation

Incidental Mutation 'R7655:Col6a2'

591144

Institutional Source

Beutler Lab

Gene Symbol

Col6a2

Ensembl Gene

ENSMUSG00000020241

Gene Name

collagen, type VI, alpha 2

Synonyms

Col6a-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7655 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76595762-76623630 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 76607756 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 492 (Q492K)

Ref Sequence

ENSEMBL: ENSMUSP00000001181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001181] [ENSMUST00000105413]

AlphaFold

Q02788

Predicted Effect

probably benign
Transcript: ENSMUST00000001181
AA Change: Q492K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000001181
Gene: ENSMUSG00000020241
AA Change: Q492K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	59	246	9.55e-29	SMART
Pfam:Collagen	269	329	3.3e-11	PFAM
Pfam:Collagen	317	383	6.2e-10	PFAM
Pfam:Collagen	366	430	2.2e-8	PFAM
Pfam:Collagen	424	483	1.7e-9	PFAM
low complexity region	502	517	N/A	INTRINSIC
Pfam:Collagen	546	605	1.1e-9	PFAM
VWA	628	816	7.51e-36	SMART
VWA	846	1029	3.97e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105413
AA Change: Q492K

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101053
Gene: ENSMUSG00000020241
AA Change: Q492K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	59	246	9.55e-29	SMART
Pfam:Collagen	269	330	5.2e-12	PFAM
Pfam:Collagen	316	384	6.1e-10	PFAM
Pfam:Collagen	364	431	1.4e-8	PFAM
Pfam:Collagen	424	483	5.3e-10	PFAM
Pfam:Collagen	475	542	3.3e-9	PFAM
Pfam:Collagen	531	605	7.4e-8	PFAM
VWA	628	816	7.51e-36	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	A	G	12: 83,992,917	Y400C	probably benign	Het
Agbl1	A	G	7: 76,409,332	M237V		Het
Arntl2	A	G	6: 146,806,442	T21A	probably benign	Het
Atrnl1	C	A	19: 57,611,379	S9*	probably null	Het
BC031181	A	T	18: 75,009,335	K71*	probably null	Het
Brpf1	A	T	6: 113,314,874	M294L	probably benign	Het
Camk2g	T	G	14: 20,739,342	D382A	possibly damaging	Het
Ccdc33	T	A	9: 58,118,465	R94W	probably damaging	Het
Cd244	T	A	1: 171,577,255	L225Q	probably damaging	Het
Chsy1	G	T	7: 66,171,030	V338F	probably damaging	Het
Col14a1	A	G	15: 55,362,450	I170V	unknown	Het
Dnah12	G	T	14: 26,859,316	V3168L	probably benign	Het
Dnah7a	T	C	1: 53,496,005	S2699G	possibly damaging	Het
Fam206a	A	G	4: 56,804,218	I78V	probably benign	Het
Fsip2	A	G	2: 82,977,542	K1402E	possibly damaging	Het
Ghdc	C	T	11: 100,769,667	A127T	probably benign	Het
Glp1r	T	C	17: 30,930,598		probably null	Het
Gm15922	T	C	7: 3,739,282	E82G	probably damaging	Het
Gm19410	A	T	8: 35,809,099	M1637L	probably benign	Het
Gm906	T	G	13: 50,247,086	K401N	probably benign	Het
Grm5	T	G	7: 88,130,251	D998E	probably benign	Het
Krtcap3	A	G	5: 31,252,560	T157A	probably damaging	Het
Luc7l2	A	G	6: 38,603,464	R333G	unknown	Het
Mdc1	T	G	17: 35,850,881	S895R	probably benign	Het
Mef2a	G	A	7: 67,295,394	T80M	probably damaging	Het
Mitd1	T	A	1: 37,885,275	I65F	probably benign	Het
Mms19	A	G	19: 41,944,572	L1026P	probably damaging	Het
Mtbp	G	T	15: 55,609,526	V629L	unknown	Het
Ncapd3	T	A	9: 27,055,505	I545N	possibly damaging	Het
Nin	G	A	12: 70,042,768	T1291M		Het
Olfr1487	A	T	19: 13,619,833	I181F	probably damaging	Het
Olfr419	T	A	1: 174,250,218	K236N	probably damaging	Het
Orc3	G	T	4: 34,587,032	C352*	probably null	Het
Oxct2b	G	A	4: 123,117,757	G490D	probably benign	Het
Pcdhb16	A	T	18: 37,479,405	T473S	probably benign	Het
Phkg2	G	A	7: 127,582,902	G365D	probably damaging	Het
Ppp2r3a	A	T	9: 101,211,712	F471I	probably benign	Het
Prl3d1	T	C	13: 27,100,035	C196R	possibly damaging	Het
Prmt1	A	T	7: 44,984,128	F14L	probably benign	Het
Prox1	A	G	1: 190,162,221	L9P	probably damaging	Het
Ptpn13	T	A	5: 103,540,983	F881I	probably benign	Het
Rab3ip	A	G	10: 116,914,139	I363T	probably benign	Het
Rapgef3	T	C	15: 97,761,209	E134G	probably damaging	Het
Rapgef6	C	T	11: 54,694,453	P1559L	probably benign	Het
Rnf180	T	C	13: 105,167,588	K507E	probably damaging	Het
Rpl3l	T	C	17: 24,730,986	I53T	probably benign	Het
Rtl1	T	C	12: 109,591,008	I1466V	unknown	Het
Saxo2	A	G	7: 82,635,351	Y100H	probably damaging	Het
Selenoh	G	T	2: 84,670,380	R39S	probably damaging	Het
Sgsm2	A	G	11: 74,865,497	V342A	probably damaging	Het
Slc26a9	T	A	1: 131,763,244	F587I	possibly damaging	Het
Smoc1	A	T	12: 81,105,908	Q91L	possibly damaging	Het
Spag9	A	C	11: 93,996,563	H98P	possibly damaging	Het
T2	T	A	17: 8,418,215	C337*	probably null	Het
Tbc1d19	A	G	5: 53,897,035	Y455C	probably damaging	Het
Thbd	A	G	2: 148,407,420	L176P	probably damaging	Het
Tmem116	A	G	5: 121,452,189		probably null	Het
Tmem25	C	T	9: 44,798,343	V54I	possibly damaging	Het
Trpm4	C	T	7: 45,321,809	V378I	probably benign	Het
Trrap	G	T	5: 144,842,612	W3129C	probably damaging	Het
Ttn	A	T	2: 76,728,316	D29740E	probably damaging	Het
Vcan	C	T	13: 89,685,114	C3073Y	probably damaging	Het
Xrra1	T	A	7: 99,910,982	D388E	probably benign	Het

Other mutations in Col6a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Col6a2	APN	10	76614534	missense	probably damaging	0.96
IGL01995:Col6a2	APN	10	76604842	splice site	probably benign
IGL02005:Col6a2	APN	10	76610173	missense	probably damaging	1.00
IGL02793:Col6a2	APN	10	76596310	missense	possibly damaging	0.96
IGL03144:Col6a2	APN	10	76614425	missense	probably benign
piddling	UTSW	10	76608106	critical splice donor site	probably null
R0137:Col6a2	UTSW	10	76596425	missense	probably damaging	1.00
R0371:Col6a2	UTSW	10	76614473	missense	probably benign	0.25
R0423:Col6a2	UTSW	10	76614917	missense	possibly damaging	0.85
R0554:Col6a2	UTSW	10	76611161	critical splice donor site	probably null
R0781:Col6a2	UTSW	10	76607740	missense	probably benign	0.00
R0831:Col6a2	UTSW	10	76604105	missense	probably damaging	1.00
R1110:Col6a2	UTSW	10	76607740	missense	probably benign	0.00
R1499:Col6a2	UTSW	10	76603710	missense	probably damaging	1.00
R1502:Col6a2	UTSW	10	76614678	missense	probably benign	0.00
R1854:Col6a2	UTSW	10	76614812	missense	probably damaging	0.98
R1878:Col6a2	UTSW	10	76614788	missense	probably benign	0.00
R3410:Col6a2	UTSW	10	76603359	missense	probably benign	0.17
R4110:Col6a2	UTSW	10	76606169	splice site	probably null
R4242:Col6a2	UTSW	10	76608106	critical splice donor site	probably null
R5562:Col6a2	UTSW	10	76599675	nonsense	probably null
R5603:Col6a2	UTSW	10	76596769	missense	probably damaging	1.00
R5641:Col6a2	UTSW	10	76613278	missense	probably damaging	1.00
R5681:Col6a2	UTSW	10	76609251	splice site	probably null
R5707:Col6a2	UTSW	10	76611031	missense	possibly damaging	0.95
R5735:Col6a2	UTSW	10	76599893	missense	probably benign	0.32
R5789:Col6a2	UTSW	10	76604389	missense	probably damaging	1.00
R6134:Col6a2	UTSW	10	76607144	missense	probably damaging	0.97
R6156:Col6a2	UTSW	10	76604170	missense	possibly damaging	0.92
R6208:Col6a2	UTSW	10	76615057	missense	possibly damaging	0.88
R6296:Col6a2	UTSW	10	76611049	missense	probably damaging	1.00
R6328:Col6a2	UTSW	10	76614378	missense	possibly damaging	0.67
R6329:Col6a2	UTSW	10	76599828	missense	probably benign	0.01
R6722:Col6a2	UTSW	10	76614558	missense	probably damaging	0.98
R7012:Col6a2	UTSW	10	76614677	missense	possibly damaging	0.95
R7091:Col6a2	UTSW	10	76615091	missense	unknown
R7422:Col6a2	UTSW	10	76603336	nonsense	probably null
R7656:Col6a2	UTSW	10	76607756	missense	probably benign	0.00
R7802:Col6a2	UTSW	10	76603798	missense	probably damaging	1.00
R7986:Col6a2	UTSW	10	76615138	missense	probably benign
R8156:Col6a2	UTSW	10	76596791	missense	possibly damaging	0.91
R8233:Col6a2	UTSW	10	76608706	critical splice donor site	probably null
R8501:Col6a2	UTSW	10	76603557	missense	probably damaging	0.99
R8826:Col6a2	UTSW	10	76603599	missense	probably damaging	0.99
R8885:Col6a2	UTSW	10	76614907	nonsense	probably null
R8948:Col6a2	UTSW	10	76610693	missense	probably damaging	1.00
R8989:Col6a2	UTSW	10	76604181	missense	probably damaging	1.00
RF020:Col6a2	UTSW	10	76606209	critical splice acceptor site	probably null
Z1177:Col6a2	UTSW	10	76596350	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCATGGCCAAGGTAGGGAAC -3'
(R):5'- AAGAGATCTGTGCCCAGTACCTC -3'

Sequencing Primer
(F):5'- CCAAGGTAGGGAACAGGTG -3'
(R):5'- CCAAGGCAAGTCCATGGCAG -3'

Posted On

2019-11-12