Mutagenetix > Incidental Mutation

Incidental Mutation 'R7655:Rapgef6'

591146

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7655 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 54694453 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1559 (P1559L)

Ref Sequence

ENSEMBL: ENSMUSP00000147135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000207429]

AlphaFold

Q5NCJ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101206
AA Change: P1562L

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: P1562L

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102743
AA Change: P1554L

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: P1554L

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136494

SMART Domains

Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533

Domain	Start	End	E-Value	Type
low complexity region	47	55	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207429
AA Change: P1559L

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	A	G	12: 83,992,917	Y400C	probably benign	Het
Agbl1	A	G	7: 76,409,332	M237V		Het
Arntl2	A	G	6: 146,806,442	T21A	probably benign	Het
Atrnl1	C	A	19: 57,611,379	S9*	probably null	Het
BC031181	A	T	18: 75,009,335	K71*	probably null	Het
Brpf1	A	T	6: 113,314,874	M294L	probably benign	Het
Camk2g	T	G	14: 20,739,342	D382A	possibly damaging	Het
Ccdc33	T	A	9: 58,118,465	R94W	probably damaging	Het
Cd244	T	A	1: 171,577,255	L225Q	probably damaging	Het
Chsy1	G	T	7: 66,171,030	V338F	probably damaging	Het
Col14a1	A	G	15: 55,362,450	I170V	unknown	Het
Col6a2	G	T	10: 76,607,756	Q492K	probably benign	Het
Dnah12	G	T	14: 26,859,316	V3168L	probably benign	Het
Dnah7a	T	C	1: 53,496,005	S2699G	possibly damaging	Het
Fam206a	A	G	4: 56,804,218	I78V	probably benign	Het
Fsip2	A	G	2: 82,977,542	K1402E	possibly damaging	Het
Ghdc	C	T	11: 100,769,667	A127T	probably benign	Het
Glp1r	T	C	17: 30,930,598		probably null	Het
Gm15922	T	C	7: 3,739,282	E82G	probably damaging	Het
Gm19410	A	T	8: 35,809,099	M1637L	probably benign	Het
Gm906	T	G	13: 50,247,086	K401N	probably benign	Het
Grm5	T	G	7: 88,130,251	D998E	probably benign	Het
Krtcap3	A	G	5: 31,252,560	T157A	probably damaging	Het
Luc7l2	A	G	6: 38,603,464	R333G	unknown	Het
Mdc1	T	G	17: 35,850,881	S895R	probably benign	Het
Mef2a	G	A	7: 67,295,394	T80M	probably damaging	Het
Mitd1	T	A	1: 37,885,275	I65F	probably benign	Het
Mms19	A	G	19: 41,944,572	L1026P	probably damaging	Het
Mtbp	G	T	15: 55,609,526	V629L	unknown	Het
Ncapd3	T	A	9: 27,055,505	I545N	possibly damaging	Het
Nin	G	A	12: 70,042,768	T1291M		Het
Olfr1487	A	T	19: 13,619,833	I181F	probably damaging	Het
Olfr419	T	A	1: 174,250,218	K236N	probably damaging	Het
Orc3	G	T	4: 34,587,032	C352*	probably null	Het
Oxct2b	G	A	4: 123,117,757	G490D	probably benign	Het
Pcdhb16	A	T	18: 37,479,405	T473S	probably benign	Het
Phkg2	G	A	7: 127,582,902	G365D	probably damaging	Het
Ppp2r3a	A	T	9: 101,211,712	F471I	probably benign	Het
Prl3d1	T	C	13: 27,100,035	C196R	possibly damaging	Het
Prmt1	A	T	7: 44,984,128	F14L	probably benign	Het
Prox1	A	G	1: 190,162,221	L9P	probably damaging	Het
Ptpn13	T	A	5: 103,540,983	F881I	probably benign	Het
Rab3ip	A	G	10: 116,914,139	I363T	probably benign	Het
Rapgef3	T	C	15: 97,761,209	E134G	probably damaging	Het
Rnf180	T	C	13: 105,167,588	K507E	probably damaging	Het
Rpl3l	T	C	17: 24,730,986	I53T	probably benign	Het
Rtl1	T	C	12: 109,591,008	I1466V	unknown	Het
Saxo2	A	G	7: 82,635,351	Y100H	probably damaging	Het
Selenoh	G	T	2: 84,670,380	R39S	probably damaging	Het
Sgsm2	A	G	11: 74,865,497	V342A	probably damaging	Het
Slc26a9	T	A	1: 131,763,244	F587I	possibly damaging	Het
Smoc1	A	T	12: 81,105,908	Q91L	possibly damaging	Het
Spag9	A	C	11: 93,996,563	H98P	possibly damaging	Het
T2	T	A	17: 8,418,215	C337*	probably null	Het
Tbc1d19	A	G	5: 53,897,035	Y455C	probably damaging	Het
Thbd	A	G	2: 148,407,420	L176P	probably damaging	Het
Tmem116	A	G	5: 121,452,189		probably null	Het
Tmem25	C	T	9: 44,798,343	V54I	possibly damaging	Het
Trpm4	C	T	7: 45,321,809	V378I	probably benign	Het
Trrap	G	T	5: 144,842,612	W3129C	probably damaging	Het
Ttn	A	T	2: 76,728,316	D29740E	probably damaging	Het
Vcan	C	T	13: 89,685,114	C3073Y	probably damaging	Het
Xrra1	T	A	7: 99,910,982	D388E	probably benign	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTGTGTCACCTCACCCAAG -3'
(R):5'- TGCCAGGTTTGCACAAGTG -3'

Sequencing Primer
(F):5'- TGTGTCACCTCACCCAAGAAAGG -3'
(R):5'- CTTAGTAGTGCTGGAGACTGACCC -3'

Posted On

2019-11-12