Mutagenetix > Incidental Mutations

Incidental Mutation 'R7655:Spag9'

591148

Institutional Source

Beutler Lab

Gene Symbol

Spag9

Ensembl Gene

ENSMUSG00000020859

Gene Name

sperm associated antigen 9

Synonyms

syd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik

MMRRC Submission

Accession Numbers

Genbank: NM_027569; MGI: 1918084

Is this an essential gene?

Possibly essential (E-score: 0.723) question?

Stock #

R7655 (G1)

Quality Score

175.009

Status

Not validated

Chromosome

Chromosomal Location

93996091-94126085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 93996563 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 98 (H98P)

Ref Sequence

ENSEMBL: ENSMUSP00000042271 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041956]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041956
AA Change: H98P

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859
AA Change: H98P

Domain	Start	End	E-Value	Type
Pfam:Jnk-SapK_ap_N	24	179	2e-61	PFAM
Pfam:JIP_LZII	390	460	5.3e-32	PFAM
coiled coil region	710	744	N/A	INTRINSIC
low complexity region	873	889	N/A	INTRINSIC
SCOP:d1kb0a2	961	1107	1e-5	SMART
Blast:WD40	1062	1102	1e-17	BLAST
low complexity region	1270	1288	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	A	G	12: 83,992,917	Y400C	probably benign	Het
Agbl1	A	G	7: 76,409,332	M237V		Het
Arntl2	A	G	6: 146,806,442	T21A	probably benign	Het
Atrnl1	C	A	19: 57,611,379	S9*	probably null	Het
BC031181	A	T	18: 75,009,335	K71*	probably null	Het
Brpf1	A	T	6: 113,314,874	M294L	probably benign	Het
Camk2g	T	G	14: 20,739,342	D382A	possibly damaging	Het
Ccdc33	T	A	9: 58,118,465	R94W	probably damaging	Het
Cd244	T	A	1: 171,577,255	L225Q	probably damaging	Het
Chsy1	G	T	7: 66,171,030	V338F	probably damaging	Het
Col14a1	A	G	15: 55,362,450	I170V	unknown	Het
Col6a2	G	T	10: 76,607,756	Q492K	probably benign	Het
Dnah12	G	T	14: 26,859,316	V3168L	probably benign	Het
Dnah7a	T	C	1: 53,496,005	S2699G	possibly damaging	Het
Fam206a	A	G	4: 56,804,218	I78V	probably benign	Het
Fsip2	A	G	2: 82,977,542	K1402E	possibly damaging	Het
Ghdc	C	T	11: 100,769,667	A127T	probably benign	Het
Glp1r	T	C	17: 30,930,598		probably null	Het
Gm15922	T	C	7: 3,739,282	E82G	probably damaging	Het
Gm19410	A	T	8: 35,809,099	M1637L	probably benign	Het
Gm906	T	G	13: 50,247,086	K401N	probably benign	Het
Grm5	T	G	7: 88,130,251	D998E	probably benign	Het
Krtcap3	A	G	5: 31,252,560	T157A	probably damaging	Het
Luc7l2	A	G	6: 38,603,464	R333G	unknown	Het
Mdc1	T	G	17: 35,850,881	S895R	probably benign	Het
Mef2a	G	A	7: 67,295,394	T80M	probably damaging	Het
Mitd1	T	A	1: 37,885,275	I65F	probably benign	Het
Mms19	A	G	19: 41,944,572	L1026P	probably damaging	Het
Mtbp	G	T	15: 55,609,526	V629L	unknown	Het
Ncapd3	T	A	9: 27,055,505	I545N	possibly damaging	Het
Nin	G	A	12: 70,042,768	T1291M		Het
Olfr1487	A	T	19: 13,619,833	I181F	probably damaging	Het
Olfr419	T	A	1: 174,250,218	K236N	probably damaging	Het
Orc3	G	T	4: 34,587,032	C352*	probably null	Het
Oxct2b	G	A	4: 123,117,757	G490D	probably benign	Het
Pcdhb16	A	T	18: 37,479,405	T473S	probably benign	Het
Phkg2	G	A	7: 127,582,902	G365D	probably damaging	Het
Ppp2r3a	A	T	9: 101,211,712	F471I	probably benign	Het
Prl3d1	T	C	13: 27,100,035	C196R	possibly damaging	Het
Prmt1	A	T	7: 44,984,128	F14L	probably benign	Het
Prox1	A	G	1: 190,162,221	L9P	probably damaging	Het
Ptpn13	T	A	5: 103,540,983	F881I	probably benign	Het
Rab3ip	A	G	10: 116,914,139	I363T	probably benign	Het
Rapgef3	T	C	15: 97,761,209	E134G	probably damaging	Het
Rapgef6	C	T	11: 54,694,453	P1559L	probably benign	Het
Rnf180	T	C	13: 105,167,588	K507E	probably damaging	Het
Rpl3l	T	C	17: 24,730,986	I53T	probably benign	Het
Rtl1	T	C	12: 109,591,008	I1466V	unknown	Het
Saxo2	A	G	7: 82,635,351	Y100H	probably damaging	Het
Selenoh	G	T	2: 84,670,380	R39S	probably damaging	Het
Sgsm2	A	G	11: 74,865,497	V342A	probably damaging	Het
Slc26a9	T	A	1: 131,763,244	F587I	possibly damaging	Het
Smoc1	A	T	12: 81,105,908	Q91L	possibly damaging	Het
T2	T	A	17: 8,418,215	C337*	probably null	Het
Tbc1d19	A	G	5: 53,897,035	Y455C	probably damaging	Het
Thbd	A	G	2: 148,407,420	L176P	probably damaging	Het
Tmem116	A	G	5: 121,452,189		probably null	Het
Tmem25	C	T	9: 44,798,343	V54I	possibly damaging	Het
Trpm4	C	T	7: 45,321,809	V378I	probably benign	Het
Trrap	G	T	5: 144,842,612	W3129C	probably damaging	Het
Ttn	A	T	2: 76,728,316	D29740E	probably damaging	Het
Vcan	C	T	13: 89,685,114	C3073Y	probably damaging	Het
Xrra1	T	A	7: 99,910,982	D388E	probably benign	Het

Other mutations in Spag9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Spag9	APN	11	94097866	missense	probably benign	0.02
IGL01776:Spag9	APN	11	94116727	splice site	probably benign
IGL02095:Spag9	APN	11	94108582	missense	probably damaging	1.00
IGL02307:Spag9	APN	11	94102160	critical splice donor site	probably null
IGL02417:Spag9	APN	11	94116741	missense	probably benign	0.27
IGL02480:Spag9	APN	11	94108587	nonsense	probably null
IGL02864:Spag9	APN	11	94106661	missense	probably damaging	1.00
IGL02976:Spag9	APN	11	94083953	missense	probably benign	0.30
IGL02979:Spag9	APN	11	94097364	missense	probably benign
IGL03349:Spag9	APN	11	94093509	missense	possibly damaging	0.51
dazzle	UTSW	11	94093624	nonsense	probably null
R0128:Spag9	UTSW	11	94093539	missense	probably damaging	1.00
R0418:Spag9	UTSW	11	94091753	splice site	probably benign
R1463:Spag9	UTSW	11	94116837	missense	probably damaging	1.00
R1593:Spag9	UTSW	11	94097233	missense	probably damaging	1.00
R1605:Spag9	UTSW	11	94048539	missense	probably damaging	0.99
R1649:Spag9	UTSW	11	94108452	splice site	probably null
R1697:Spag9	UTSW	11	93996565	missense	probably benign	0.00
R1952:Spag9	UTSW	11	94097358	missense	possibly damaging	0.77
R2011:Spag9	UTSW	11	94092375	nonsense	probably null
R2012:Spag9	UTSW	11	94092375	nonsense	probably null
R2351:Spag9	UTSW	11	94092900	missense	probably damaging	1.00
R2367:Spag9	UTSW	11	94116757	missense	probably damaging	1.00
R3027:Spag9	UTSW	11	94086377	missense	probably null	1.00
R3766:Spag9	UTSW	11	94060283	intron	probably benign
R3777:Spag9	UTSW	11	94099026	critical splice acceptor site	probably null
R3937:Spag9	UTSW	11	94044417	missense	possibly damaging	0.94
R3937:Spag9	UTSW	11	94044479	missense	possibly damaging	0.92
R4417:Spag9	UTSW	11	94060346	intron	probably benign
R4445:Spag9	UTSW	11	94097253	missense	possibly damaging	0.95
R4711:Spag9	UTSW	11	94114351	critical splice donor site	probably null
R4799:Spag9	UTSW	11	94048516	missense	possibly damaging	0.87
R4799:Spag9	UTSW	11	94048517	missense	probably damaging	0.96
R4816:Spag9	UTSW	11	94048599	intron	probably benign
R4843:Spag9	UTSW	11	94097818	missense	probably damaging	1.00
R5020:Spag9	UTSW	11	94097786	missense	probably benign	0.08
R5119:Spag9	UTSW	11	94122722	missense	probably damaging	1.00
R5298:Spag9	UTSW	11	94100135	missense	probably damaging	1.00
R5304:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5305:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5395:Spag9	UTSW	11	94091751	splice site	probably null
R5636:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5638:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5654:Spag9	UTSW	11	94090712	missense	probably damaging	1.00
R5779:Spag9	UTSW	11	94114253	missense	probably benign	0.20
R5814:Spag9	UTSW	11	94082828	missense	possibly damaging	0.94
R5912:Spag9	UTSW	11	94044425	missense	probably damaging	0.98
R6038:Spag9	UTSW	11	94112092	missense	probably damaging	1.00
R6038:Spag9	UTSW	11	94112092	missense	probably damaging	1.00
R6269:Spag9	UTSW	11	94044507	missense	probably benign	0.05
R6294:Spag9	UTSW	11	94093485	critical splice acceptor site	probably null
R6389:Spag9	UTSW	11	94086311	missense	probably damaging	1.00
R6420:Spag9	UTSW	11	94086302	missense	probably damaging	1.00
R6460:Spag9	UTSW	11	94068975	missense	probably damaging	1.00
R6482:Spag9	UTSW	11	94093502	missense	possibly damaging	0.94
R6860:Spag9	UTSW	11	94081370	missense	probably benign	0.25
R7086:Spag9	UTSW	11	94097864	missense	probably benign
R7179:Spag9	UTSW	11	94089432	splice site	probably null
R7225:Spag9	UTSW	11	94097358	missense	probably damaging	0.98
R7351:Spag9	UTSW	11	94092976	missense	probably benign	0.00
R7366:Spag9	UTSW	11	94108521	missense	possibly damaging	0.56
R7378:Spag9	UTSW	11	94114351	critical splice donor site	probably null
R7401:Spag9	UTSW	11	94097689	missense	probably benign
R7506:Spag9	UTSW	11	94108464	missense	probably damaging	1.00
R7507:Spag9	UTSW	11	94068080	missense	probably benign	0.00
R7513:Spag9	UTSW	11	94112083	missense	probably damaging	1.00
R7656:Spag9	UTSW	11	93996563	missense	possibly damaging	0.56
R7664:Spag9	UTSW	11	94102160	critical splice donor site	probably null
R7665:Spag9	UTSW	11	94013654	missense	probably damaging	0.98
R7862:Spag9	UTSW	11	94112066	missense	possibly damaging	0.69
R8074:Spag9	UTSW	11	94112051	missense	probably damaging	1.00
R8085:Spag9	UTSW	11	94099044	missense	probably benign
R8469:Spag9	UTSW	11	94091801	missense	probably damaging	1.00
R8547:Spag9	UTSW	11	94122821	missense	possibly damaging	0.84
R8709:Spag9	UTSW	11	94068090	missense	probably benign	0.02
R8732:Spag9	UTSW	11	94071688	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTACGATGAGGAGGTGGTC -3'
(R):5'- GATGCCAGAGTGTCGCTTCC -3'

Sequencing Primer
(F):5'- TCAAGGAGCTGATGCCACTG -3'
(R):5'- TCTCCTGGACACTCGCTGG -3'

Posted On

2019-11-12